منبع پایان نامه درمورد تحلیل داده، امام خمینی

دانلود پایان نامه

یک میکروتیوپ جدید که با اطلاعات لازم لیبل دار شده است، ریخته شد. میکروتیوپ‏ها در دمای 20- درجه سانتی گراد نگهداری می‌شوند.
3-10- بررسی کیفیت و کمیت DNAاستخراج شده:
پس از استخراج، DNA به کمک دستگاه اسپکتروفتومتر مورد بررسی قرار گرفت.
1-صفر کردن دستگاه: داخل یک کووت29 تمیز، 2 λ از همان بافر شستشو که برای رقیق کردن به کار رفت ریخته شد. دستگاه روی DNA دو رشته‏ای30و طول موج 260 نانومتر تنظیم شد. با استفاده از کلید Blank دستگاه صفر شد. (ما چون از آب مقطر استفاده کردیم دستگاه را باآب مقطر صفر کردیم. )
2-کووت حاوی محلول در دستگاه قرار داده شد. بااستفاده از کلید Sample، محاسبات مربوط به تعیین غلظت و درجه خلوص به صورت اتوماتیک به وسیله دستگاه انجام شده و عدد نهایی ارائه گردید.
3-11- راه اندازی و انجام PCR:
PCR، روشی in vitroاست که سبب تکثیر یک توالی معین از DNA دو رشته‏ای با استفاده از پرایمر‌های الیگو نوکلئوتیدی می‏شود.این روش توسط Kary Mullis در سال 1983 ابداع شد. در این تکنیک اصول همانند سازی DNA در داخل سلول زنده تقلید و تکرار می‏شود و بااستفاده از ترکیبات ضروری موجود در یک سیستم بافری، ناحیه‏ای از یک مولکولDNA الگو توسط آنزیم تکثیر می‏شود. پرایمرها قطعات الیگو نوکلئوتیدی مکمل توالی مورد نظر هستند و ناحیه الگوبرداری را مشخص می‌کنند. (Kennedy, 2011)
هر سیکل PCR شامل چند مرحله است:
مرحله شروع:31
دمای بالا به طور معمول 94-98 به مدت 1 تا 9 دقیقه، برای فعال کردن آنزیم مقاوم به دمای بالای Taq پلیمراز
مرحله واسرشت:32
باز شدن دو رشته الگو به واسطه حرارت، دما معمولاً 93-95 درجه سانتیگراد و زمان 20 تا 30 ثانیه می‌باشد.
مرحله اتصال:33
در این مرحله پرایمرها توالی مکمل را روی رشته الگو شناسایی نموده و به آن وصل می‌شوند. تنظیم دمای این مرحله بسیار مهم است. دمای ذوب TM))، دمایی است که برای شکستن هر باند AT دو درجه و برای شکستن هر باند GC چهار درجه حرارت لازم است. (فرمول 3-1)
فرمول(3-1): TM=2(A+T)+4(G+C)
مرحله طویل شدن:
آنزیم Taq پلیمراز با افزودن داکسی نوکلئوتیدها (dNTPs) به گروه‌های3΄-OH پرایمرها، سنتز رشته جدید را شروع نموده و مولکول دو رشته‏ای جدید تولید می‏شود. دمای بهینه برای فعالیت آنزیم Taq پلیمراز معمولاً 72 تا 75 درجه سانتی گراد است. تمامی ‌این مراحل توسط دستگاه ترموسایکلر که قابل برنامه ریزی است انجام می‏شود. (Kennedy, 2011)
3-12- واکنشPCR
مواد مورد نیاز:
1)Taqپلیمراز:
یک آنزیمDNA پلیمراز مقاوم به حرارت است که از یک باکتری به نام ترموس اکواتیکوس جدا شده است. دارای فعالیت پلیمرازی (اگزونوکلئازی) 5 ΄به 3΄است. ولی فاقد فعالیت اگزونوکلئازی 3΄به 5΄است. در نتیجه نمیتواند اشتباهات را تصحیح34 نماید. ،PH،اپتیمم برای فعالیت آن حدود 9و نیمه عمر آن در حرارت 95درجه، 40 دقیقه است.
2)دزوکسی نوکلئوتید‏ها (dNTPs):
شاملdTTP، dGTP، dCTP، dATP به طور مساوی است.
3) بافرهای PCR :
اجزا بافر مورد استفاده در مورد سایر پلیمرازهای مقاوم به حرارت متفاوت است، لذا عموما بافر 10X همراه با آنزیم مربوطه می‌باشد.
4)کاتیون‌های دوظرفیتی:
کاتیون دو ظرفیتی معمول در طی واکنش PCR، Mg2+ می‌باشد که در مرحله اتصال پرایمر با تثبیت بر هم کنش پرایمر-DNA اهمیت دارد. و دیگر اهمیت آن ایجاد ثبات در اتصال آنزیم پلیمراز به کمپلکس پرایمر- DNAمی‌باشد.
5)پرایمرها:
الیگونوکلئوتیدهایی به طول 15 تا 30 نوکلئوتید می‌باشند که اصلی ترین عامل اختصاصی شدن PCR هستند.
6)الگو:
توالی هدف می‌باشد که یا به صورت تک رشته و یا دو رشته‏ای است.
موارد 1 تا 4 به نسبت‌های مناسب با هم مخلوط شده‏اند و محلولی حاصل شده است که 2X Master Mix نامیده می‏شود. برای واکنش‌های PCR این Master Mix باید به صورت1X استفاده شود.
3-12-1-شرایط و مواد مورد استفاده در واکنش PCR:
ما در این پژوهش از 2X PCR Master Mix که از شرکت ویراژن خریداری کردیم استفاده کردیم. سپس از پرایمر Forwardو Reverse به کار رفت. و در نهایت Template DNA و باDDW، به حجم 25 lμ میرسانیم. سپس نمونه‏ها را درون دستگاه PCR گذاشته و برنامه‏ی آنها را تنظیم می‌کنیم.
قابل ذکر می‌باشد به همراه نمونه ها از یک نمونه سویه استاندارد هموفیلوس آنفلوانزاNTHI با (PTCC:1766) و یا (ATCC: 49766 ) به عنوان کنترل مثبت استفاده شد. و همین طور به جای Template DNA از آب مقطر در یک اپندورف به عنوان کنترل منفی استفاده شد.
جدول3-1- مواد تشکیل دهنده و مقدار حجم آنها برای PCRازompP2
volume ( μl)
PCR reaction components
12. 5 μl
2X PCR Master Mix
0. 5 μl
Forward primer
0. 5 μl
Reverse primer
2 μl
Template DNA
9. 5 μl
DDW

مطلب مشابه :  منابع پایان نامه ارشد درموردکارکنان بانک، عملکرد سازمان، اعتماد متقابل، سلسله مراتب

به علت حساسیت آنزیمTaq پلیمراز همه‌ی مراحل محلول‌سازی PCR باید روی یخ انجام گیرد. و همچنین میکروتیوپ‌ها35در مراحل مختلف انجام کار، به صورت کوتاه ورتکس36 شوند تا تمام مواد به خوبی با هم ترکیب شوند. در اخر همه‏ی میکروتیوپ‌ها را باید اسپین37 کرد و درون دستگاه ترموسایکلر38 قرار داد. (شکل3-3)

شکل 3-3- دستگاه ترموسایکلر
جدول 3-2- برنامه PCR برای تکثیر ژن ompP2
برنامه PCR
تعدادسیکل
زمان
درجه حرارت
مرحله
2
5min
C 94o
Initial Denaturation
1

25
1sec
94oC
Denaturation
Annealing
Extension

2

1sec
60oC

1sec
72oC

1
10min
72oC
Final Extension
3
توالی پرایمرهای مورد استفاده در این بخش مطالعه بااستفاده از نرم افزار Gen Runner و سایر نرم افزارهای موجود در اینترنت
طراحی گردیده و از طریق سایت NCBI. nlm. nih. gov/BLAST ، BLAST شد. و به شرکت تکاپوزیست جهت طراحی ارسال شد.
جدول3-3- توالی پرایمرهای مورد استفاده برای ompP2
منابع
برنامه مورده استفاده
اندازه محصول PCR
توالی پرایمر (5΄-3΄)
نام پرایمر
ژن
ردیف
This study
OmpP2
1173b
AACAACGAAGGGACTAAAGTAGAATTAGGC
CGCGTAAACCTACACCCACTGATTTTTC
F
R
OmpP2
1

3-13- الکتروفورز محصول PCR:
3-13-1- مواد و وسایل مورد نیاز:
• تانک الکتروفورز(Electrophoresis tank)
• منبع تغذیه الکتریکی(power supply)
• اگارز(Agarose)
• محلول0. 5xTris-Hcl Boric Acid EDTA)TBE)
• دستگاه GelDoc
3-13-2- نحوه تهیه ژل اگارز و انجام الکتروفورز:
به میزان لازم پودر اگارز را با (0. 5X )TBE در داخل بشر مخلوط گردید. سپس این مخلوط در مایکروویو قرار داده شد تا محلول جوشیده و شفاف شود. سپس این مایع را درون کستی میریزیم که از قبل درون آن شانه قرار داده ایم می‌ریزیم. پس از گذشت مدت زمان لازم (حدود 15 دقیقه) ژل بسته شده و کاملاً سفت شد، شانه را به آرامی‌، به طوری که چاهک‏ها پاره نشوند از ژل خارج می‌کنیم و ژل را به تانک حاوی بافر TBE منتقل می‌کنیم (; Larson et al, 1986 Janson et al, 1993). سپس محصولات PCR و نمونه کنترل مثبت و منفی و DNAمارکر، را بر روی ژل الکتروفورز ران می‌کنیم. وقتی رنگ آبی (مواد درون چاهک ها) به انتهای ژل رسید، جریان برق را قطع کرده و ژل را به مدت 20 دقیقه درون اتیدیوم برماید قرار داده پس از آن درون ظرف آب به مدت 20 دقیقه قرار می‌دهیم تااز غلظت ماده اتیدیوم بروماید کم شود. زیرا اتیدیوم یک ماده فوق العاده سمی‌ و سرطان زا است. پس از آن ژل را درون دستگاه GelDoc قرار داده، و از آن در زیر نور UV عکس تهیه می‌کنیم. (Alrawi, 2002)

شکل 3-4- دستگاهالکتروفورز
3-14- تفسیر ژل الکتروفورز
با توجه به باند‌های مشاهده شده، حضور یا فقدان ژن‌های مورد نظر در هر یک از نمونه‏ها در قیاس با مارکر تفسیر شد و از طرفی با توجه به عدم تشکیل باند در کنترل منفی، عدم آلودگی نمونه‏ها تائید شد. (Prasadarao et al, 1999)
3-15- RFLP
این تکنیک کاربرد‌های بسیاری دارد از جمله تشخیص پلی مورفیسم قطعات PCR شده با یک جفت پرایمر یکسان. هر یک از آنزیم‌های محدودالاثر39 روی توالی‌هایDNA دارای سایت یک سایت برش منحصر به فرد است. چنانچه دو قطعه با وزن مولکولی یکسان که از استخراج DNA حاصل شده است وجود داشته باشد، باید آنزیم الگو‌های یکسان بررشی ایجاد نماید. اما اگر الگو‌های حاصل از برش متفاوت باشد، نشان دهنده وقوع جهش در توالی DNAدر مکانهای برش آنزیم می‌باشد. در نتیجه عملکرد آنزیم‌های محدودالاثر روی آنها الگوهای متفاوتی روی ژل الکتروفورز نشان می‌دهد.
هدف از انجام این تکنیک صرفا برای بررسی پلی مورفیسم باندهایDNA با وزن مولکولی یکسان PCR شده ژن ompP2 می‌باشد.
3-15-1- استخراج باند اصلی از روی ژل اگارز
به این علت که ما نتوانستیم در مرحلهPCR کلیه باند‌های غیر اختصاصی را حذف کنیم و این باند‏ها در مرحله بعدی که تکنیک RFLP می‌باشد برای ما مشکل ساز می‌باشد. محصول PCR را بر روی ژل ران می‌کنیم سپس باند اصلی را که باندbp 1173می‌باشد را بریده ودرون اپندورف انداخته و بااستفاده از کیت استخراج از روش ژل DNA ‏ها رااز ژل جدا می‌کنیم. تا فقط بر روی باند اصلی آنزیم محدودالاثر برش ایجاد نماید.
ازکیت استخراج از روی ژل شرکت(Feldon )استفاده شد.
3-15-2- بررسی غلظت محصولات تخلیص شده توسط دستگاه نانودراپ40:
توسط دستگاه نانودراپ غلظت محصولات تخلیص شده PCR اندازه گیری شد. همچنین با استفاده از نانودراپ مقدار ناخالصی ناشی از حضور پروتئین و یاRNA در محلول را می‌توان تعیین نمود. با استفاده از جذب نوری که در 280 نانومتر اندازه گیری می‏شود و نسبت A260 به A280 محاسبه می‏شود. در نمونه خالص این نسبت باید عددی بین 1. 5 تا 1. 8 باشد، هر چه نسبت محاسبه شده کمتر از این باشد نشان دهنده آلودگی با پروتئین است و هر چقدر بیشتر باشد، آلودگی باRNA است.

مطلب مشابه :  دانلود پایان نامه ارشد با موضوعدوران باستان، فرهنگ و تمدن، سلسله مراتب

3-16- مواد و وسایل لازمبرای RFLP:
• محصول PCR ژن ompP2
• آنزیم محدودالاثرAlu 1
• بافر آنزیم محدودالاثر
• اپندورف
• سمپلر و سر سمپلر
• انکوباتور 37 درجه
3-16-1- روش انجام RFLP باآنزیمAlu1:
ابتدا در داخل اپندورف‏ها مقدار 17 میکرولیتر محصول PCR، 2 میکرولیتر بافر آنزیم، 1 میکرولیتر آنزیم محدودالاثر Alu1 می‌ریزیم. آنها را به خوبی سمپلینگ و میکس کرده (ورتکس انجام نشود. ). نمونه‏ها را طبق دستور العمل آنزیم به مدت 3 ساعت در انکوباتور 37 درجه سانتی گراد قرار می‌دهیم. تا انکوبه شوند و سپس با ولتاژ پایین 60 در ژل اگارز 1. 5 درصد الکتروفورز می‌کنیم.
3-16-2- انجامRFLP باآنزیم محدودالاثر EcoR1:
وقتی ما الگوهایی که پس ازاضافه کردن آنزیمAlu1 باید داشته باشیم را با استفاده از سایت http://tools. neb. com/NEBcutter2/index. php دراوردیم، مشاهده کردیم باید چهار گروه داشته باشیم که دو گروه آن بااین آنزیم سایت برش مشابهی می‌دهند یعنی فقط یک قطعه 1026 مشاهده می‌کنیم و قطعه دیگر147 که به سختی مشاهده می‏شود.در نتیجه برای جدا کردن این دو گروه باید از آنزیم دیگری که الگو متفاوتی می‌دهد استفاده نماییم که ما آنزیمEcoR1 راانتخاب نمودیم. روش کار آن مشابه آنزیمAlu1 می‌باشد.
3-17- تعیین توالی41و پردازش داده ها:
این تکنیک امکان دسترسی میکروبیولوژیست‏ها را به ژن‌های مختلف می‌دهد. بیشتر برای تعیین توالی از روش سانگر(سانجر) استفاده می‌کنند. ارائه خدمات تعیین توالی توسط آزمایشگاه‌هایی که اختصاص به
این کار دارند و دارای تجهیزات پیشرفته هستند، انجام می‏شود. برای تعیین توالی یک قطعه PCRشده دو روش عمده وجود دارد:
1-کلون کردن محصول PCR شده روی پلاسمید و ارسال آن برای تعیین توالی
2-ارسال مستقیم محصول PCR شده برای تعیین توالی
در این مطالعه از روش دوم استفاده شد.
3-17-1- ارسال نمونه‏ها جهت توالی یابی قطعه تکثیر شده:
نمونه‌هایPCR شده منتخب برای تعیین توالی (25میکرولیتر)، پرایمرهای F و R (به حجم 15 میکرولیتر و غلظت 10p. mol) در اپندورف‌های 1. 5، به همراه عکس ژل نمونه‏ها که دارای باندbp 1173ژن ompP2 به شرکت تکاپوزیست فرستاده شد. باید توجه داشت نمونه‏ها حتما بر روی یخ قرار داشته باشند.
نتیجه تعیین توالی از طریق نرم افزارMega4 مشاهده و بررسی گردید و BLAST آنها در EMBL/Gene Bank databases انجام شد. (www. ncbi. nlm. nih. gov/BLAST). سکانس مربوط به نمونه‏ها بعد از آنالیز توسط نرم افزار Mega4 در (www. ncbi. nlm. nih. gov/BLAST) گزارش و ثبت گردید.

فصل چهارم:
تجزیه و تحلیل داده ها

4-1- تعداد نمونه‏ها و ایزولاسیون:
تعداد30 نمونه از بیمارستان میلاد و امام خمینی از شهریور 1389 تا شهریور 1391جمع‌آوری گردید. ایزوله‌ها از نمونه‌های متفاوت بیماران عفونی شامل حلق، چشم، بینی جدا شده است. )جدول 4-1)
جدول 4-1- اطلاعات نمونه‌های دریافتی از بیماران مورد مطالعه
توضیحات
محل جداسازی
سن بیمار
شماره ایزوله
NTHi
چشم
یک ماهه
1
NTHi
چشم

2
NTHi
چشم

3
NTHi
تنفسی
نوزاد
4
NTHi
مایع شستشوی ریه

5
NTHi
حلق
سه ماهه
6
NTHi
حلق
1 ساله
7
NTHi
حلق
4ساله
8
NTHi
حلق
31 ساله
9
NTHi
حلق
28 ساله
10
NTHi
حلق
32 ساله
11
NTHi
حلق

12
NTHi
بیماری تنفسی

13
NTHi
بیماری تنفسی
1 ساله
14
NTHi
بیماری تنفسی
2
30
NTHi
بیماری تنفسی
1
35
NTHi
بیماری تنفسی
4
37
NTHi

1
38
NTHi
بیماری تنفسی
6 ماه
40
NTHi
بیماری تنفسی
6
43
NTHi

2
47
NTHi
بیماری تنفسی
2
49
NTHi
بیماری تنفسی
6 ماه
52
NTHi

5
89
NTHi

3
103
NTHi
بیماری تنفسی
4
104
NTHi

2
109
NTHi
بیماری تنفسی
6 ماه
119
NTHi


120
NTHi
بیماری تنفسی

132
4-2-تستهای بیوشیمیایی:
پس از کشت و خالص سازی نمونه‌ها، جهت تایید حضور و رشد هموفیلوس آنفلوانزا، از تست‌های بیوشیمیایی اکسیداز،کاتالاز،اوره از، ایندول استفاده شد. اکسیداز مثبت،کاتالاز مثبت،اوره آز مثبت، تولید ایندول مثبت ،اورنیتین دکربوکسیلاز مثبت بود.
4-3-نتایج بررسی کمیت و کیفیت DNA استخراج شده:
جدول 4-2 نتایج بررسی کمیت و کیفیت DNA استخراج شده
Ng/nl
280/260
شماره

دیدگاهتان را بنویسید