دسته: پایان نامه ها و مقالات

منبع پایان نامه درمورد Haemophilus، influenzae، Infect، membrane

بخش‌های متغیر دارای بخش‌های حفاظت شده می‌باشد که می‌توان از آنها به عنوان کاندیدای واکسن استفاده کرد. با توجه به اینکه واکسن فعلی با استفاده از PRP ساخته می‏شود ،بعلت جنس پلی ساکاریدی این آنتی ژن، در بدن افراد و بخصوص کودکان زیر 2 سال، ایمنی فعال ایجاد نمی‌کند. همین طورPRP آنتی ژن مختص سویه‌های کپسول دار به حساب می‌آید. اما آنتی ژن‌های پروتئینی همان طور که بیان نمودیم قادر به ایجاد ایمنی فعال وابسته به لنفوسیت T در تمام سویه‌های باکتری هستند.

پیشنهادات:
1-در سویه‌های بیشتری از هموفیلوس آنفلوانزا پلی مورفیسم ژن ompP2 بررسی شود.
2-بیان ژن پروتئین P2 توسط تکنیک Real time PCR بررسی شود.
3-مطالعات بی زیانی و توکسیسیتی پروتئین P2 روی مدل‌های حیوانی انجام شود و سپس وارد فازهای بالینی گردد.
4-در مدلهای حیوانی، ارزیابی ایمونولوژیکی پروتئین P2 انجام شود.
5-بر روی انواع سروتایپ این باکتری، آنالیز مولکولی این ژن انجام شود.
6-تکرار این مطالعه با تعداد بیشتری سویه بالینی که از نقاط مختلف کشور ایزوله می‌شوند صورت بگیرد.
7-بهره گیری از تکنیک‌هایی همچون تکنیک
LAMP (Loop-mediated isothermal amplification of DNA) برای نواحی بسیار حفاظت شده این ژن، می‌تواند کمک موثری در اهداف تشخیصی فراهم کند.

منابع

فهرست منابع

References:
1- Ahren,l. L. ,H. Janson ,et al. (2001)Protein D expression promotes the adherence and internalization of non-typeable Haemophilus influenza into human monocytic cells. Microbial Pathogenesis 31(3):151-158.
2- Alrawi, A. M., K. C. Chern, el al. (2002). Biotypes and serotypes of Haemophilus influenzae molecular isolates.British Journal of ophthalmology 86(3):276-277.
3- Berenson CS, Murphy TF, Wrona CT, Sethi S. Outer membrane protein p6 ofnontypeable Haemophilus influenzae is a potent andselective inducer of human macrophageproinflammatory cytokines. Infect Immun. 2005;73: 2728-2735.
4- Breukels MA, Spanjaard L, Sanders LA, Rijkers GT. Immunological characterization of conjugated Haemophilus influenzae type b vaccine failure in infants.Clin Infect Dis. 2001; 32:1700.
5- Cotter D, Manson K, Howell AP, Fink DL, Green BA. Immunization with Haemophilus influenzae Hapadhesin protects against nasopharyngeal colonizationin experimental mice. J Infect Dis. 2002; 186:1115-1121.
6- Cotter SE, Yeo HJ, JuehneT, St Geme I. Architecture and adhesive activity of the Haemophilus influenza Hsfadhesin. وJBacteriol. 2005; 187:4656-4664.
7- Doran L. Fink 1, 2,3Amy Z. Buscher1, 2, 3, Bruce Green4, phillip Fernsten4,JosephW. St. Gemel1, 2, 3, Article the first public shed online (March2003):4MAR 2003 DOI:10. 1046/j. 1462-5822.2003. 00266. x:The Haemophilus influenza Hap autotransporter mediates microcolony formation and adherence to epithelial cells and extracellular matrix via binding in the C-terminal end of the passenger domain. Cellular Microbiology Volume 5,Issue 3,pages175-186.
8- Duim B,1993. Genetic analysis of the diversity in outer membrane protein P2 of non-encapsulated Haemophilus influenza.Microbial pathogenesis,1993;14:451-462. Available from: http://books.google.com/books?id=ZXFcBAAAQBAJ&pg=PA100&lpg=PA100&dq=genetic+analysis+of+the+diversity+in+outer+membrane+protein[1392/4]
9- Dworkin,M. S. ,park,L. ,Borchardt,S. M. ,2007. The changing epidemiology of invasive Haemophilus disease ,especially in persons65 years old. clin. Infect. Dis. 44,810-816.5,Issue 3,pages175-186.
10- Dworkin,M. S. ,park,L. ,Borchardt,S. M. ,2007. The changing epidemiology of invasive Haemophilus disease ,especially in persons65 years old. clin. Infect. Dis. 44,810-816.
11- Esmaily.F,A. M. ,Tavangar. AR,Hadi. A(2011). Comparison of bacterial biomass and PRP production between different isolates of Haemophilus influenza type b (Hib) under different culture conditions.Razi vaccine &Serum Research Institute66(1):7.
12- Forbes KJ and el,1992,Variation in length and sequence of porin (ompP2) alleles of non-capsulate Haemophilus influenzae. 1992,Mol Microbiol. 2107-12. Available from: http://www.ncbi. nlm. nih. gov/pubmed/1328812[1392/5]
13- Forsgren A, Riesbeck K, Janson H. Protein D of Haemophilus influenzae: a protectivenontypeable Haemophilus influenzae antigen and acarrier for pneumococcal conjugate vaccines. . Clin Infect Dis. 2008;46: 726-731.
14- FoxwellAR,KydJM,CrippsAW. Nontypeable Haemophilusinfluenzae: pathogenesis and prevention. Microbiol Mol Biol Rev. 1998;62:294–308.
15- Goldblatt D, VazAR, Miller E. Antibody avidity as a surrogatemarker of successful priming by Haemophilus influenzatype b conjugate vaccines following infant immunization.J Infect Dis. 1998;177:1112.
16- Haase EM, Morse GD, Murphy TF.Mapping of Bactericidal Epitopes on the P2 Porin Protein of Nontypeable Haemophilus influenzae.Infect Immun. 1994;62(9):3712-22. . Available from: http://www.ncbi. nlm. nih. gov/pmc/articles/PMC303022[1392/4].
17- Hiltke, T. J. , S. Sethi, and T. F. Murphy, Sequence stability of the gene encoding outer membrane protein P2 of nontypeable Haemophilus influenzae in the human respiratory tract. J Infect Dis, 2002. 185(5): p. 627-31
18- Hiltke Tj and el,2003, Horizontal transfer of the gene encoding outer membrane protein P2 of nontypeable Haemophilus influenzae, in a patient with chronic obstructive pulmonary disease. 2003,PUBMED,1;188(1):114-7. http://www.ncbi. nlm. nih. gov/pubmed/12825179,[1392/4]
19- Hiltke Tj el,2002. Sequence stability of the gene encoding outer membrane protein P2 of nontypeable Haemophilus influenzae in the human respiratory tract.J Infect Dis. 2002 Mar 1;185(5):627-3,Available from: http://www. ncbi. nlm. nih. gov/pubmed/11865419,[1393/3]
20- Inoshima,Y. ,A. Morooka,et al. (2000)Simple preparation of parapoxvius genome DNA for endonuclease analysis. Microbiology and Immunology 44(1):69-72.
21- Ishida Y،Abe Y،Yanaia M،Kobayashi H،Harabuch Y. Identification of human T-cell epitopes and highlyimmunogenic analog peptides on the non-typeableHaemophilus-influenzae P6 outer membrane protein.Clin Immunol. 2006;121:90-99.
22- Janson,H. ,M. Ruan,et al. (1993). Limited diversity of the Protein –D gene (HPI)amoung encapsulated and noncapsulated Haemophilus-Influenzae strains. Infection and Immunity 61(11):4546-4552.
23- Kennedy S. ,Oswald N. ,PCR Troubleshooting and optimization :The Essential Guide ,1stedn. 2011. Available from: http://www.amazon. com/PCR-Troubleshooting –Optimization-Essential-Guide/dp/1904455727.
24- Kubiet, M. and Ramphal, R. (1995) Adhesion of nontypeable Haemophilusinfluenzae from blood and sputum to human tracheobronchial mucins andlactoferrin. Infect. Immun. 63,899–902.
25- Kyd JM, Cripps AM, Novotny LA, Bakaletz LO. Efficacy of the 26-Kilodalton Outer Membrane Protein and Two P5Fimbrin-Derived Immunogens To Induce Clearance of NontypeableHaemophilus influenzae from the Rat Middle Ear and Lungs asWell as from the Chinchilla Middle Ear and Nasopharynx. Infect Immun. 2003;71(8):4691-4699.
26- Ladhani,S. ,Slack,M. P. ,White,j. ,Ramsay,Fall in Haemophilus influenezae serotype b(Hib) disease following implementation of a boostercampain. Arch. Dis. child.93,665669.
27- Larson,T. J. ,Ehrmann,et al. (1983). Periplasmic Glycerophosphodiester phosphodiesterase of
Escherichia –Coli,A New Enzyme of the Glp Regulon. journal of Biological Chemistry 258(9):5428-5432.
28- Lindberg A. Glycoprotein conjugate vaccines. Vaccine.1999;17:s28-s36. 44-Ada G, Isaacs D. Carbohydrate- protein vaccines.Clin Microbiol Infect. 2003; 9:79-85.
29- Orkin ,S. (1990). Molecular cloning a laboratorymanual,2nedition,sambrook,j ,Fritsch, EF,Maniatis,T. Nature 343(6259)604-605.
30- Mandell GL, Bennett JE, Dollin R. Principles and practice of infectious disease.7th edition, Churchill Livingstone, Elsevier;2010,1, P. 1079-1171.
31- Mandell GL, Bennett JE, Dollin R. Principles and practice of infectious disease.7th edition, Churchill Livingstone, Elsevier;2010,vol. 2, P. 2911-2921.
32- Manson ,RS,et al,Purfication and comparison of outer membrane protein P2 from Haemophilus influenza Type b isolates. Clinical Investigation.1983;72(2):677–684. doi:10. 1172/JCI111017. Available from: http://www.jci.org/articles/view/111017[1393/3]
33- Martin, D. , et al. , Mapping of B-cell epitopes on the outer membrane P2 porin protein of Haemophilus influenzae by using recombinant proteins and synthetic peptides.Infect Immun, 1991. 59(4): p. 1457-64
34- Metcalf BJ.Production of thelapidated formof the Peptidoglycan-associatedlipoproteinsofgram-negativebacteria. Available from: http://www. faqs. org/patents/app/20090060952).
35- Meyers,J. A. ,D. Sanchez,et al. (1976). Simple agarose-gel electrophoretic method for identification and characterization of plasmid deoxyribonucleic-acid.Journal of Bacteriology 127(3):1529-1537.
36- Moreno, E. 1999.Purification and characterization of smooth and rough lipopolysaccharides from Brucella abortus. Infect. Immun. 43: 779
37- Murley YM, Edlind TD, Plett PA, LiPuma JJ.Cloning of thehaemocin locus of Haemophilus influenzaetype b and assessment of the role of haemocinin virulence.Microbiology.1998;144: 2531-2533.
38- Murphy TF, Bartos LA, Campagnari AA, Nelson MB, Apicella MA.Antigenic -Characterization of the P6 Protein of Nontypable Haemophilus influenzae. Infect Immun. 1986;54(3):774-779.
39- Murphy TF, Pastor P, Medley F, Osterholm MT, GranoffDM.Decreased Haemophilus colonization in children vaccinatedwith Haemophilus influenzae type b conjugate vaccine.J Pediatr.1993;122:517.
40- Murphy TF.Respiratory infections caused by non-typeable Haemophilusinfluenzae. Curr Opin Infect Dis 2003;16:129–34.
41- Musser, J. M. , Barenkamp, S. J. , Granoff, D. M. , and Selander, R. K. (1986)Genetic relationships of serologically nontypeable and serotype b strains ofHaemophilus influenzae. Infect. Immun. 52,183–191.
42- Nakamura M, Asaka T, Kirita A, Miyazaki H, Senda Y, Fujita SI, Fukushima R. Occurrence of the Fimbria GenehifA in Clinical Isolates of nonencapsulated-Haemophilus influenzae. Microbiol Immunol. 2006; 50:327-329.
43- Niazi A. Rahman,Comparison of Virulence Determinants of DifferentStrains of Haemophilusinfluenzae. School of Biomedical Science,Curtin University of Technology, Perth WA,Australia,2009.
44- Peltola H. Worldwide Haemophilus influenzae Type b Disease at the Beginningof the 21st Century: Global Analysis of the Disease Burden25 Years after the Use of the Polysaccharide Vaccineand a Decade after the Advent of Conjugates. Clin Microbiol Rev. 2000;13(2):302-317.
45- Prasadarao,N. V. ,E. Lysenko,et al. (1999). Opacity associated protein a contributes to the binding of Haemophilus influenza to chang epithelial cells. Infection and Immunity 67(8):41534160.
46- Pickering Jerry W, Martins Thomas B,Schroder M. Carl and Hill Harry R. ,2002,Comparison of a multiplex flow cytometric assay with enzyme-linked immunosorbent assay for quantitation of antibodies to tetanus,Diphtheria and Haemophilus influenzatype b. Clin vaccine. Immunol,9(4): 879-876.
47- Prymula R, Peeters P, Chrobok V, Kriz P, Novakova E, Kaliskova E, et al. Pneumococcal capsular polysaccharides conjugated to protein D for prevention of acute otitis media caused by both Streptococcus pneumoniae and non-typableHaemophilus influenzae: a randomised double-blindefficacy study. Lancet.2006; 367:740-748.
48- Reddy, M. S. , Bernstein, J. M. , Murphy, T. F. , Faden, H. (1996) Bindingbetween outer membrane proteins of nontypeable Haemophilus influenzae andhuman nasopharyngeal mucin. Infect. Immun. 64.1447–1449.
49- Read,T. D. ,S. W. Satola,et al. (1998). Copy number of pilus gene clusters in Haemophilus Influenzae and variation in the hifE pilin gene. Infection and Immunity 66(4):1622-1631.
50- Roche R. and Maxon.E,1995,Phenotype variation in Haemophilus influenza:The Interrelationship of colony opacity,conjugate and rotavirus vaccines in national immunization schedules,Health Econ. 9:19-35Bishai,Howard,Winkelstein,and Smith,1994,Characterization and Virulence Analysis of Catalas Mutants of Haemophilus influenza,Infection and Immunity,P. 48554860.
51- San Martin,B. ,L. Lapierre,et al. (2008).

منبع پایان نامه درمورد Haemophilus، gene، samples، influenzae

. (2008). Characterization of antibiotic resistance genes linked to class 1 and 2 integrons in strains of Salmonella spp. isolated from swine. Canadian journal of microbiology 54(7):569-576.
52- Sanders J D And el,1993, Reconstitution of a porin-deficient mutant of Haemophilus influenzae type b with a porin gene from nontypeable H. influenzae. 1993,nfect Immun,v. 61(9); PMC281101. Available from: http://www.ncbi. nlm. nih. gov/pmc/articles/PMC281101>[1392/5]
53- Schouls L, van der Heide H, Witteveen S, Zomer B, Burger M,Schot C. Two variants among Haemophilus influenzae serotypeb strains with distinct bcs4, hcsA and hcsB genesdisplay differences in expression of the polysaccharide capsule.BMC Microbiol.2008;8:35.
54- Sharifat Salmani A, Siadat S. D, Ahmadi H, Nejati M, Norouzian D, TabaraieB, Abbasi M, Karbasian M, Mohabati Mobarez A, Shapouri R. Optimization ofBrucella abortus S99 lipopolysaccharide extraction by phenol and Butanolmethods. Res J Bio Sci 3(6):576-580, 2008.
55- Sikkema, D. J. and T. F. Murphy, Molecular analysis of the P2 porin protein of nontypeable Haemophilus influenzae.Infect Immun, 1992. 60(12): p. 5204-11
56- Snow,J. B. (2002). Progress in the prevention of otitis media through immunization. Otology &Neurotology 23(1):1-2.
57- Stellwagen,E. and N. C. Stellwagen(2002). The free solution mobility of DNA in Tris-acetate EDTA buffers of different concentrations,with and without added Nacl. Electrophoresis 23(12):19351941.
58- Sukupolvi-Petty S،Grass S،St Geme I. The Haemophilus influenzae Type b hcsAand hcsB gene products facilitate transport of capsularpolysaccharide across the outer membrane and areessential for virulence. J Bacteriol.2006;188: 3870-3877
59- Swords WE, Chance DL, Cohn LA, Shao J, Apicella MA, Smith AL. AcylationofthelipooligosaccharideofHaemophilusinfluenzae andcolonization: an htrb mutation diminishes thecolonization of human airway epithelial cells. Infect Immun. 2002;70: 4661–4668
60- Swords WE, Ketterer MR, Shao J, CampbellCA, Weiser JN, Apicella MA.Bindingofthenon-typeableHaemophilusinfluenzaelipooligosaccharide to the PAF receptor initiates host cell signalling. Cell Microbiol.2001; 3: 525-538
61- Tibor, A. 1995.Pyrogen test.In: United states pharmacopoeia 23rd,Revision, U. S. pharmacopeial Convention.Inc. , Rockville, M. D. , D. 1718
62- Van Ham SM, van Alphen L, Mooi FR, van Putten JP. Contribution of themajorandminorsubunitstofimbria-mediatedadherenceofHaemophilus influenzae to human epithelial cells and erythrocytes.Infect Immun. 1995;63: 4883-4889
63- Varela et al.Membrane Protein as Novel Targets for Vaccine Production in Haemophilus influenzae and Neisseria meningitidis Vaccines Vaccin 2012, 3:6 Available from: http://dx.doi. org/10. 4172/2157-7560. 1000152,[1392/12].
64- Winkelstein JA،Moxon ER.The role of complement in thehost’s defense against Haemophilus influenzae.J Infect Dis. 1992; 165 (Suppl. 1):S62.
65- Winn WS, Allen W, Janda E. Koneman G,Procop P. Koneman’s color atlas and textbook of diagnostic Microbiology. 6th edition,Philadelphia, Lippincott Williams and Wilkins, 2006.
66- the Basis of Nanotechnology Development at TRIUMF: How Application Begin”،canada’s Nanotecnology Laratory For particle And nuclear Physics Available from: http:/www.triumf. info/public/repository/ Hb/Hb20309. pdf”
67- http:/www.Com.Msu.edu / reusch / virtual. Tekd / Spectrpy / nmr / nmr). Ntm.

Abstract
Haemophilus influenzae is a Gram negative and specific human pathogen that causes acute bacterial meningitis , septicemia , epiglotitis , bacterimia , otitis media . the goal of this study is one of the conserved proteins in this bacterium and designing of a domestic vaccine against it. ProteinP2 (38-40 KDa ) comprises more than 50 percent of all the proteins in outer membrane of Haemophilus and is expressesed by non-capsulated strains of H.influenzae type b.
This protein is indictaed as a proper candidate for vaccine to non-capsulated Haemophilus influenzae .in this study , epidemiology of ompP2 gene was surveyed using clinical samples isolated from 30 patients . the bacteria were cultured in chocolate agar mediaand Biochemical tests performed for them. After DNA purification , PCR method was performed for samples . all the samples were positive for ompP2 gene . after sequencing of 6 samples and comparison of ompP2 gene in all samples with domestic strains that exist in Gene Bank , similarities and differences due to nucleotide deletion , addition or translocation were defined by MEGA 4 software.
PCR products were digested by Alu1 and EcoR1 for defining of polymorphism patterns in given gene. Cutting patterns in 21 samples (98%-99%) were similar to domestic samples and 9 (91%-98%) of them were distinct. our results are indicated that ompP2 gene organization is similar to distinct strains of Haemophilus ifluenzae recorded in Gene Bank (accessionno: J3359.1, M93268.1, M93269.1, M93270.1) and polymorphism has occurred in cutting region by Alu1 enzyme. Thus this protein can be considered as a potential vaccine of Haemophilus in future studies.

Key word: Haemophilus influenzae, vaccine, ompP2 gene

پیوست ها

«پیوست الف»
Display Settings:
• GenBank
Format
• Summary
• GenBank
• GenBank (full)
• FASTA
• FASTA (text)
• Graphics
• ASN.1a
• Revision History
• Accession List
• GI List
Apply
Send:
• Complete Record
• Coding Sequences
• Gene Features
Choose Destination
• File
• Clipboard
• Collections
• Analysis Tool
• Format
Create File
Add to Clipboard
Add to Collections
Choose Sequence Analysis Tool
• BLAST
• PrimerBLAST
Submit
Download features.
• Format
Create File
Download gene features.
• Format
Create File

منبع پایان نامه درمورد تحلیل داده، امام خمینی

یک میکروتیوپ جدید که با اطلاعات لازم لیبل دار شده است، ریخته شد. میکروتیوپ‏ها در دمای 20- درجه سانتی گراد نگهداری می‌شوند.
3-10- بررسی کیفیت و کمیت DNAاستخراج شده:
پس از استخراج، DNA به کمک دستگاه اسپکتروفتومتر مورد بررسی قرار گرفت.
1-صفر کردن دستگاه: داخل یک کووت29 تمیز، 2 λ از همان بافر شستشو که برای رقیق کردن به کار رفت ریخته شد. دستگاه روی DNA دو رشته‏ای30و طول موج 260 نانومتر تنظیم شد. با استفاده از کلید Blank دستگاه صفر شد. (ما چون از آب مقطر استفاده کردیم دستگاه را باآب مقطر صفر کردیم. )
2-کووت حاوی محلول در دستگاه قرار داده شد. بااستفاده از کلید Sample، محاسبات مربوط به تعیین غلظت و درجه خلوص به صورت اتوماتیک به وسیله دستگاه انجام شده و عدد نهایی ارائه گردید.
3-11- راه اندازی و انجام PCR:
PCR، روشی in vitroاست که سبب تکثیر یک توالی معین از DNA دو رشته‏ای با استفاده از پرایمر‌های الیگو نوکلئوتیدی می‏شود.این روش توسط Kary Mullis در سال 1983 ابداع شد. در این تکنیک اصول همانند سازی DNA در داخل سلول زنده تقلید و تکرار می‏شود و بااستفاده از ترکیبات ضروری موجود در یک سیستم بافری، ناحیه‏ای از یک مولکولDNA الگو توسط آنزیم تکثیر می‏شود. پرایمرها قطعات الیگو نوکلئوتیدی مکمل توالی مورد نظر هستند و ناحیه الگوبرداری را مشخص می‌کنند. (Kennedy, 2011)
هر سیکل PCR شامل چند مرحله است:
مرحله شروع:31
دمای بالا به طور معمول 94-98 به مدت 1 تا 9 دقیقه، برای فعال کردن آنزیم مقاوم به دمای بالای Taq پلیمراز
مرحله واسرشت:32
باز شدن دو رشته الگو به واسطه حرارت، دما معمولاً 93-95 درجه سانتیگراد و زمان 20 تا 30 ثانیه می‌باشد.
مرحله اتصال:33
در این مرحله پرایمرها توالی مکمل را روی رشته الگو شناسایی نموده و به آن وصل می‌شوند. تنظیم دمای این مرحله بسیار مهم است. دمای ذوب TM))، دمایی است که برای شکستن هر باند AT دو درجه و برای شکستن هر باند GC چهار درجه حرارت لازم است. (فرمول 3-1)
فرمول(3-1): TM=2(A+T)+4(G+C)
مرحله طویل شدن:
آنزیم Taq پلیمراز با افزودن داکسی نوکلئوتیدها (dNTPs) به گروه‌های3΄-OH پرایمرها، سنتز رشته جدید را شروع نموده و مولکول دو رشته‏ای جدید تولید می‏شود. دمای بهینه برای فعالیت آنزیم Taq پلیمراز معمولاً 72 تا 75 درجه سانتی گراد است. تمامی ‌این مراحل توسط دستگاه ترموسایکلر که قابل برنامه ریزی است انجام می‏شود. (Kennedy, 2011)
3-12- واکنشPCR
مواد مورد نیاز:
1)Taqپلیمراز:
یک آنزیمDNA پلیمراز مقاوم به حرارت است که از یک باکتری به نام ترموس اکواتیکوس جدا شده است. دارای فعالیت پلیمرازی (اگزونوکلئازی) 5 ΄به 3΄است. ولی فاقد فعالیت اگزونوکلئازی 3΄به 5΄است. در نتیجه نمیتواند اشتباهات را تصحیح34 نماید. ،PH،اپتیمم برای فعالیت آن حدود 9و نیمه عمر آن در حرارت 95درجه، 40 دقیقه است.
2)دزوکسی نوکلئوتید‏ها (dNTPs):
شاملdTTP، dGTP، dCTP، dATP به طور مساوی است.
3) بافرهای PCR :
اجزا بافر مورد استفاده در مورد سایر پلیمرازهای مقاوم به حرارت متفاوت است، لذا عموما بافر 10X همراه با آنزیم مربوطه می‌باشد.
4)کاتیون‌های دوظرفیتی:
کاتیون دو ظرفیتی معمول در طی واکنش PCR، Mg2+ می‌باشد که در مرحله اتصال پرایمر با تثبیت بر هم کنش پرایمر-DNA اهمیت دارد. و دیگر اهمیت آن ایجاد ثبات در اتصال آنزیم پلیمراز به کمپلکس پرایمر- DNAمی‌باشد.
5)پرایمرها:
الیگونوکلئوتیدهایی به طول 15 تا 30 نوکلئوتید می‌باشند که اصلی ترین عامل اختصاصی شدن PCR هستند.
6)الگو:
توالی هدف می‌باشد که یا به صورت تک رشته و یا دو رشته‏ای است.
موارد 1 تا 4 به نسبت‌های مناسب با هم مخلوط شده‏اند و محلولی حاصل شده است که 2X Master Mix نامیده می‏شود. برای واکنش‌های PCR این Master Mix باید به صورت1X استفاده شود.
3-12-1-شرایط و مواد مورد استفاده در واکنش PCR:
ما در این پژوهش از 2X PCR Master Mix که از شرکت ویراژن خریداری کردیم استفاده کردیم. سپس از پرایمر Forwardو Reverse به کار رفت. و در نهایت Template DNA و باDDW، به حجم 25 lμ میرسانیم. سپس نمونه‏ها را درون دستگاه PCR گذاشته و برنامه‏ی آنها را تنظیم می‌کنیم.
قابل ذکر می‌باشد به همراه نمونه ها از یک نمونه سویه استاندارد هموفیلوس آنفلوانزاNTHI با (PTCC:1766) و یا (ATCC: 49766 ) به عنوان کنترل مثبت استفاده شد. و همین طور به جای Template DNA از آب مقطر در یک اپندورف به عنوان کنترل منفی استفاده شد.
جدول3-1- مواد تشکیل دهنده و مقدار حجم آنها برای PCRازompP2
volume ( μl)
PCR reaction components
12. 5 μl
2X PCR Master Mix
0. 5 μl
Forward primer
0. 5 μl
Reverse primer
2 μl
Template DNA
9. 5 μl
DDW

به علت حساسیت آنزیمTaq پلیمراز همه‌ی مراحل محلول‌سازی PCR باید روی یخ انجام گیرد. و همچنین میکروتیوپ‌ها35در مراحل مختلف انجام کار، به صورت کوتاه ورتکس36 شوند تا تمام مواد به خوبی با هم ترکیب شوند. در اخر همه‏ی میکروتیوپ‌ها را باید اسپین37 کرد و درون دستگاه ترموسایکلر38 قرار داد. (شکل3-3)

شکل 3-3- دستگاه ترموسایکلر
جدول 3-2- برنامه PCR برای تکثیر ژن ompP2
برنامه PCR
تعدادسیکل
زمان
درجه حرارت
مرحله
2
5min
C 94o
Initial Denaturation
1

25
1sec
94oC
Denaturation
Annealing
Extension

2

1sec
60oC

1sec
72oC

1
10min
72oC
Final Extension
3
توالی پرایمرهای مورد استفاده در این بخش مطالعه بااستفاده از نرم افزار Gen Runner و سایر نرم افزارهای موجود در اینترنت
طراحی گردیده و از طریق سایت NCBI. nlm. nih. gov/BLAST ، BLAST شد. و به شرکت تکاپوزیست جهت طراحی ارسال شد.
جدول3-3- توالی پرایمرهای مورد استفاده برای ompP2
منابع
برنامه مورده استفاده
اندازه محصول PCR
توالی پرایمر (5΄-3΄)
نام پرایمر
ژن
ردیف
This study
OmpP2
1173b
AACAACGAAGGGACTAAAGTAGAATTAGGC
CGCGTAAACCTACACCCACTGATTTTTC
F
R
OmpP2
1

3-13- الکتروفورز محصول PCR:
3-13-1- مواد و وسایل مورد نیاز:
• تانک الکتروفورز(Electrophoresis tank)
• منبع تغذیه الکتریکی(power supply)
• اگارز(Agarose)
• محلول0. 5xTris-Hcl Boric Acid EDTA)TBE)
• دستگاه GelDoc
3-13-2- نحوه تهیه ژل اگارز و انجام الکتروفورز:
به میزان لازم پودر اگارز را با (0. 5X )TBE در داخل بشر مخلوط گردید. سپس این مخلوط در مایکروویو قرار داده شد تا محلول جوشیده و شفاف شود. سپس این مایع را درون کستی میریزیم که از قبل درون آن شانه قرار داده ایم می‌ریزیم. پس از گذشت مدت زمان لازم (حدود 15 دقیقه) ژل بسته شده و کاملاً سفت شد، شانه را به آرامی‌، به طوری که چاهک‏ها پاره نشوند از ژل خارج می‌کنیم و ژل را به تانک حاوی بافر TBE منتقل می‌کنیم (; Larson et al, 1986 Janson et al, 1993). سپس محصولات PCR و نمونه کنترل مثبت و منفی و DNAمارکر، را بر روی ژل الکتروفورز ران می‌کنیم. وقتی رنگ آبی (مواد درون چاهک ها) به انتهای ژل رسید، جریان برق را قطع کرده و ژل را به مدت 20 دقیقه درون اتیدیوم برماید قرار داده پس از آن درون ظرف آب به مدت 20 دقیقه قرار می‌دهیم تااز غلظت ماده اتیدیوم بروماید کم شود. زیرا اتیدیوم یک ماده فوق العاده سمی‌ و سرطان زا است. پس از آن ژل را درون دستگاه GelDoc قرار داده، و از آن در زیر نور UV عکس تهیه می‌کنیم. (Alrawi, 2002)

شکل 3-4- دستگاهالکتروفورز
3-14- تفسیر ژل الکتروفورز
با توجه به باند‌های مشاهده شده، حضور یا فقدان ژن‌های مورد نظر در هر یک از نمونه‏ها در قیاس با مارکر تفسیر شد و از طرفی با توجه به عدم تشکیل باند در کنترل منفی، عدم آلودگی نمونه‏ها تائید شد. (Prasadarao et al, 1999)
3-15- RFLP
این تکنیک کاربرد‌های بسیاری دارد از جمله تشخیص پلی مورفیسم قطعات PCR شده با یک جفت پرایمر یکسان. هر یک از آنزیم‌های محدودالاثر39 روی توالی‌هایDNA دارای سایت یک سایت برش منحصر به فرد است. چنانچه دو قطعه با وزن مولکولی یکسان که از استخراج DNA حاصل شده است وجود داشته باشد، باید آنزیم الگو‌های یکسان بررشی ایجاد نماید. اما اگر الگو‌های حاصل از برش متفاوت باشد، نشان دهنده وقوع جهش در توالی DNAدر مکانهای برش آنزیم می‌باشد. در نتیجه عملکرد آنزیم‌های محدودالاثر روی آنها الگوهای متفاوتی روی ژل الکتروفورز نشان می‌دهد.
هدف از انجام این تکنیک صرفا برای بررسی پلی مورفیسم باندهایDNA با وزن مولکولی یکسان PCR شده ژن ompP2 می‌باشد.
3-15-1- استخراج باند اصلی از روی ژل اگارز
به این علت که ما نتوانستیم در مرحلهPCR کلیه باند‌های غیر اختصاصی را حذف کنیم و این باند‏ها در مرحله بعدی که تکنیک RFLP می‌باشد برای ما مشکل ساز می‌باشد. محصول PCR را بر روی ژل ران می‌کنیم سپس باند اصلی را که باندbp 1173می‌باشد را بریده ودرون اپندورف انداخته و بااستفاده از کیت استخراج از روش ژل DNA ‏ها رااز ژل جدا می‌کنیم. تا فقط بر روی باند اصلی آنزیم محدودالاثر برش ایجاد نماید.
ازکیت استخراج از روی ژل شرکت(Feldon )استفاده شد.
3-15-2- بررسی غلظت محصولات تخلیص شده توسط دستگاه نانودراپ40:
توسط دستگاه نانودراپ غلظت محصولات تخلیص شده PCR اندازه گیری شد. همچنین با استفاده از نانودراپ مقدار ناخالصی ناشی از حضور پروتئین و یاRNA در محلول را می‌توان تعیین نمود. با استفاده از جذب نوری که در 280 نانومتر اندازه گیری می‏شود و نسبت A260 به A280 محاسبه می‏شود. در نمونه خالص این نسبت باید عددی بین 1. 5 تا 1. 8 باشد، هر چه نسبت محاسبه شده کمتر از این باشد نشان دهنده آلودگی با پروتئین است و هر چقدر بیشتر باشد، آلودگی باRNA است.

3-16- مواد و وسایل لازمبرای RFLP:
• محصول PCR ژن ompP2
• آنزیم محدودالاثرAlu 1
• بافر آنزیم محدودالاثر
• اپندورف
• سمپلر و سر سمپلر
• انکوباتور 37 درجه
3-16-1- روش انجام RFLP باآنزیمAlu1:
ابتدا در داخل اپندورف‏ها مقدار 17 میکرولیتر محصول PCR، 2 میکرولیتر بافر آنزیم، 1 میکرولیتر آنزیم محدودالاثر Alu1 می‌ریزیم. آنها را به خوبی سمپلینگ و میکس کرده (ورتکس انجام نشود. ). نمونه‏ها را طبق دستور العمل آنزیم به مدت 3 ساعت در انکوباتور 37 درجه سانتی گراد قرار می‌دهیم. تا انکوبه شوند و سپس با ولتاژ پایین 60 در ژل اگارز 1. 5 درصد الکتروفورز می‌کنیم.
3-16-2- انجامRFLP باآنزیم محدودالاثر EcoR1:
وقتی ما الگوهایی که پس ازاضافه کردن آنزیمAlu1 باید داشته باشیم را با استفاده از سایت http://tools. neb. com/NEBcutter2/index. php دراوردیم، مشاهده کردیم باید چهار گروه داشته باشیم که دو گروه آن بااین آنزیم سایت برش مشابهی می‌دهند یعنی فقط یک قطعه 1026 مشاهده می‌کنیم و قطعه دیگر147 که به سختی مشاهده می‏شود.در نتیجه برای جدا کردن این دو گروه باید از آنزیم دیگری که الگو متفاوتی می‌دهد استفاده نماییم که ما آنزیمEcoR1 راانتخاب نمودیم. روش کار آن مشابه آنزیمAlu1 می‌باشد.
3-17- تعیین توالی41و پردازش داده ها:
این تکنیک امکان دسترسی میکروبیولوژیست‏ها را به ژن‌های مختلف می‌دهد. بیشتر برای تعیین توالی از روش سانگر(سانجر) استفاده می‌کنند. ارائه خدمات تعیین توالی توسط آزمایشگاه‌هایی که اختصاص به
این کار دارند و دارای تجهیزات پیشرفته هستند، انجام می‏شود. برای تعیین توالی یک قطعه PCRشده دو روش عمده وجود دارد:
1-کلون کردن محصول PCR شده روی پلاسمید و ارسال آن برای تعیین توالی
2-ارسال مستقیم محصول PCR شده برای تعیین توالی
در این مطالعه از روش دوم استفاده شد.
3-17-1- ارسال نمونه‏ها جهت توالی یابی قطعه تکثیر شده:
نمونه‌هایPCR شده منتخب برای تعیین توالی (25میکرولیتر)، پرایمرهای F و R (به حجم 15 میکرولیتر و غلظت 10p. mol) در اپندورف‌های 1. 5، به همراه عکس ژل نمونه‏ها که دارای باندbp 1173ژن ompP2 به شرکت تکاپوزیست فرستاده شد. باید توجه داشت نمونه‏ها حتما بر روی یخ قرار داشته باشند.
نتیجه تعیین توالی از طریق نرم افزارMega4 مشاهده و بررسی گردید و BLAST آنها در EMBL/Gene Bank databases انجام شد. (www. ncbi. nlm. nih. gov/BLAST). سکانس مربوط به نمونه‏ها بعد از آنالیز توسط نرم افزار Mega4 در (www. ncbi. nlm. nih. gov/BLAST) گزارش و ثبت گردید.

فصل چهارم:
تجزیه و تحلیل داده ها

4-1- تعداد نمونه‏ها و ایزولاسیون:
تعداد30 نمونه از بیمارستان میلاد و امام خمینی از شهریور 1389 تا شهریور 1391جمع‌آوری گردید. ایزوله‌ها از نمونه‌های متفاوت بیماران عفونی شامل حلق، چشم، بینی جدا شده است. )جدول 4-1)
جدول 4-1- اطلاعات نمونه‌های دریافتی از بیماران مورد مطالعه
توضیحات
محل جداسازی
سن بیمار
شماره ایزوله
NTHi
چشم
یک ماهه
1
NTHi
چشم

2
NTHi
چشم

3
NTHi
تنفسی
نوزاد
4
NTHi
مایع شستشوی ریه

5
NTHi
حلق
سه ماهه
6
NTHi
حلق
1 ساله
7
NTHi
حلق
4ساله
8
NTHi
حلق
31 ساله
9
NTHi
حلق
28 ساله
10
NTHi
حلق
32 ساله
11
NTHi
حلق

12
NTHi
بیماری تنفسی

13
NTHi
بیماری تنفسی
1 ساله
14
NTHi
بیماری تنفسی
2
30
NTHi
بیماری تنفسی
1
35
NTHi
بیماری تنفسی
4
37
NTHi

1
38
NTHi
بیماری تنفسی
6 ماه
40
NTHi
بیماری تنفسی
6
43
NTHi

2
47
NTHi
بیماری تنفسی
2
49
NTHi
بیماری تنفسی
6 ماه
52
NTHi

5
89
NTHi

3
103
NTHi
بیماری تنفسی
4
104
NTHi

2
109
NTHi
بیماری تنفسی
6 ماه
119
NTHi


120
NTHi
بیماری تنفسی

132
4-2-تستهای بیوشیمیایی:
پس از کشت و خالص سازی نمونه‌ها، جهت تایید حضور و رشد هموفیلوس آنفلوانزا، از تست‌های بیوشیمیایی اکسیداز،کاتالاز،اوره از، ایندول استفاده شد. اکسیداز مثبت،کاتالاز مثبت،اوره آز مثبت، تولید ایندول مثبت ،اورنیتین دکربوکسیلاز مثبت بود.
4-3-نتایج بررسی کمیت و کیفیت DNA استخراج شده:
جدول 4-2 نتایج بررسی کمیت و کیفیت DNA استخراج شده
Ng/nl
280/260
شماره

پایان نامه با واژگان کلیدی فیزیولوژی

حرکت می کند و بیمار به نور خورشید خیلی حساس می شود، این تاثیر برای شش هفته ادامه می یابد. تلاش برای جلوگیری از بروز این اثر به صورت محصور شد مولکول های رنگ در داخل یک نانو ذره متخلخل منجر شد، در نتیجه رنگ در نانو ذرات باقی می ماند و به بخش های دیگر بدن پخش نمی شود، حتی اگر رنگ در نانو ذرات باقی نماند توانایی برای تولید اکسیژن بخاطر اندازه حفره(حدود 1 نانومتر) که می تواند آزادانه اکسیژن را به بیرون پخش کند، باقی نمی ماند و موثر واقع نمی شود.

2-3-1توموگرافی محاسبه شده اشعه ایکس :
توموگرافی محاسبه شده اشعه ایکس (X-ray CT )روش تشخیصی غیرتهاجمی دیگریست که تصاویر سه بعدی از سلول های مختلف براساس یک سری از تصاویر اشعه ایکس دو بعدی پیرامون یک محور چرخشی تکی ایجاد می کند. عوامل کنتراست دهنده اغلب برای افزایش کنتراست بین سلول ها بعلت میل ترکیبی آنها برای جذب اشعه ایکس بکار می رود. یکی از پرکاربردترین عوامل کنتراست دهنده توموگرافی محاسبه شده اشعه ایکس اولتراویست (Ultravist ) (iopromide) یک رنگ مولکولی کوچک یدی نام دارد.

شکل2-1 : ساختار شیمیایی اولتراویست (Ultravist ) (iopromide) ، یک عامل کنتراست بکاررفته در توموگرافی محاسبه شده اشعه ایکس

چندین نقص اولتراویست وجود دارد که شامل مسمومیت کلیوی، نشت وریدی و فاصله تصویربرداری محدود بخاطره دفع کلیوی سریع است (Kim 2007). محدودیت مشاهده شده در عوامل کنتراست دهنده CT اخیرا” با استفاده از نانو ذره مغلوب شد. نانو ذرات طلا چندین امتیاز بر عوامل کنتراست دهنده فعلی دارد مثل ضرایب بالاتر جذب اشعه ایکس ، تنوع کاربرد در تغییر سطح و کنترل منظم اندازه و شکلنانو ذرات طلا . اخیرا” کیم و همکارانش بررسه های CT را بر روی این نانو طلا با روکش پلی اتیلن گلیکول (PEG) بعنوان عامل آنتی بیوفولینگ تا آزمایش کاربردهای محیط زنده بعنوان عوامل کنتراست CT برای آنژیوگرافی و شناسایی هپاتوم انجام دادند. اندازه گیری های ضریب جذب اشعه ایکس در آزمایشگاه نشان می دهد که کاهش نانو ذرات طلا با روکش پلی اتیلن گلیکول (PEG) 5.7 بار بالاتر از اولتراویست (Ultravist ) در چنین غلظتی است. با روکش پلی اتیلن گلیکول (PEG) یک گردش خون بلندمدت تری(تقریبا” 4 ساعت بدون اتلاف ظاهری در مدل موش ها) نسبت به اولتراویست (Ultravist ) با تنها حدود 10 دقیقه دارد. این نتایج سهولت نانو ذره را بعنوان یک عامل کنتراست CT در محیط زنده نشان داد. هرچند هیچ مسمومیت قابل توجهی در سلول های کبدی در معرض نانو ذره با روکش پلی اتیلن گلیکول (PEG) برای 24 ساعت شناسایی نشد، بررسی های بیشترباید برای نانو ذرات طلا با روکش پلی اتیلن گلیکول (PEG) قبول شد تا یک عامل کنتراست مفید از لحاظ کلینیکی بررسی شود.

2-3-2 حسی زیستی ( Biosessing) :
بیو سنسورها از مولکول های زیست شناسی مثل آنتی بادی ها، آنزیم ها، کربوهیدرات ها و اسیدهای نوکلئیک برای شناسایی یا پیگیری دوره هر پدیده بیولوژیکی جالب استفاده می کند (Otsuka 2001 Mc Fadden 2002 ). واکنش ها مثل پیوند هیدروژنی و انتقالات مرحله به مرحله بین مولکول های گیرنده و لیگاند همراه با تکنیک های قابل برداشت مثل کلریمتری، فلورسانس ، پیام های بیومغناطیسی برای حس رویدادهای بیوشیمیایی خاص بکارمی روند( ( Mc Fadden 2002
بیوسنسور ها کاربردهای مختلفی دارند: پردازش غذا ، برای کنترل پاتوژن های موجود در غذا در عرضه غذا، کنترل محیطی برای شناسایی آلودگی ها و سموم در محیط، دفاع رفاه زیستی برای شناسایی باکتری ها ، ریروس ها و سموم زسیت شناسی و تشخیص های کلینیکی برای اندازه گیری سطوح گلوکز خون (Mc Fadden 2002 )
نانو ذرات طلا خواص الکترونیکی و نوری خاص مثل SPR افزایش شده ، انتشار افزایش یافته سطح و پخش رامان افزایش یافته سطح (SERS) را نشان می دهداین نانو ذرات بطور کارآمدی لومینسنس دو فوتونی را منتشر می کند زیرا آنها می توانند SPR رابا حداقل رطوبت بعد از تحریک فوتون نگه دارند . این خواص در حس یا کنترل رویدادهای مولکولی متعددی از جمله واکنش پروتئین با پروتئین، انباشتگی پروتئین و پیچیدن پروتئین بکاررفته اند (De 2007 ). برای مثال پیام های AuNPs SPR نه تنها برای شناسایی DNA ها بکاررفته اند بلکه برای تمایز میان زوج های DNA ناجورو خوب نیز بکار رفته اند. میرکین و همکارانش گزارش کردند.
نانو ذرات طلا که باآن یک مخمر iso-1-cytochorome c (Cytc) بصورت کووالانسی می چسبد ، زار و همکارانش نشان داده اند که نانو ذرات طلا را می توان بعنوان یک سنسور برای پیگیری جفت شدن یک مولکول پروتئینی بکار برد. به استناد قرار گرفتن در یک بافر با pH متفاوت ، Cytc افزودنی در pHپایین جفت نمی شوندبنابراین توده نانو ذره در حالی القا می شود که در pH بالا اتفاق بیفتد.تا منجر به ایجاد توده می شود. این تغییرات تطبیقی موجب تغییرات قابل سنجشی در رنگ نانو طلا می شود و می تواند با اسپکتروسکوپی جذب US-VIS شناسایی شود (Chah 2005). دریک چنین حالتی ، تغییرات وابسته به pHدر رزنانس پلاسمون اخیرا برای ردیابی تغییرات ساختاری پروتئین القا شده. درمان فتوترمال یک روش تجربی تقریبا تهاجمی است که برای درمان سرطان و حالات مربوطه امیدوارکننده است. این ترکیبی از 2 عنصر اصلی است : (1) منبع نور ، (2) لیزرهای خاص با یک دامنه طیفی 650-900nm برای نفوذ عمیق به بافت و(2) جذب نوری نانو طلا که پرتوافشانی نوری را در یک مقیاس زمانی پیکوپانیه به گرما تبدیل میکند و بدینوسیله موجب آبلاسیون فتوترمال می شود. (Chen 2007). پیشرفت های اخیر نشان داده است که نشان طیفی آنها را می توان ساخت یا ب
ا تنظیم شکل واندازه تنظیم کرد. . ال-ساید و همکارانش نشان دادند که میله های نانویی طلایی یک باند جذب طولی در NIR به علت نوسانات SPR دارند و بعنوان عوامل فتوترمی موثرند. نانوساختارهای طلایی دیگر مثل نانوپوسته های طلایی، قفس های نانوی طلایی و نانوکروی های طلایی نیز خرابی فتوترمی موثری از سلول ها و بافت سرطانی نشان داده اند. بااینهمه ، هدف محیط زنده موثر نانو ذرات طلا برای جمعیت نامتجانس سلول ها و بافت سرطانی هنوز به انتخاب بهتر و عدم مسمومیت به سلول های نرمال پیرامون نیاز دارد. هرچند درمان های مبنی بر نانو ذرات تاثیر خوبی برای ارائه در تومورها نشان داشته اند ، هیچ یک از تومورها تابع این تاثیر مخصوصا باتوجه به ارائه نانوذرات نسبتا بزرگ نیستند. علاوه براین،فوتوترمولیسیز برای تومورهای کوچک یا سلول های متاستاتیک تکی بکار نمی رود زیرا انتشار گرما از ذرات داغ محیط بافت آسیب دیده را در مدت زمان طولانی تر افزایش میدهد. بنابراین ، روش های دیگر ارائه نانوذرات انتخابی باید بمنظور دست یابی به درمان فتوترمال موثر ایجاد شود. بررسی های اخیر نشان داده است که AuNPs متصل به آنتی بادیها و بردارهای ویروسی را می توان برای درمان فوتوترمی موثر و انتخابی بکار برد. هوآنگ و همکارانش(2006) نشان دادند که میله های نانو طلایی متصل به آنتی بادی های گیرنده عامل رشد آنتی بادی (anti-EGFR) بطور انتخابی خطوط سلولی را هدف قرار دهند که EGFR را بیان می کند.ارائه لیزر مداوم بعدی سلول های درمان شده با نانوذرات منجر به خرابی فتوترمی سلول های مثبت EGFR در نیمی از انرژی مورد نیاز برای کشتن سلول های منفی EGFR شد. بنابراین درمان خط سلول سرطان سینه HER2 نانو پوسته های طلایی با هدف HER2 و نانوقفس ها بعد از ارائه نور لیرزبرای القای انتخابی مرگ سلولی به سلول مثبت HER2 در آزمایشگاه نشان داده شده است. ترکیبات مواد مغناطیسی اثرات جانبی بدی بسته به دوز نشان داده اند. از این گذشته ، شباهت اندازه نانو ساختار های طلا به مواد بیولوژیکی میتواند به موانع سلولی کاموفلاژ41 دهد و منجر به ورود سلولی نامطلوب شود که ممکن است برلی عملکرد سلولی نرمال مضرباشد. امید اینکه ورود سلولی نانو ذره طلا غیرعمدی می تواند منجر به اثرات جانبی سمی شود تلاش های زیادی را برای ارائه بینش بهتر به پروفیل مسمومیت می طلبد. اخیرا پن و همکارانش یک بررسی سیستمیک از سیتوتوکسیتی محلول آب بسته به اندازه نانو ساختار های طلا تثبیت شده با تریفنیل فسفونین برعلیه چهار سلول زیر انجام داده اند: سلول های اپیتلیال کارسینوم سرویکس هلا ،سلول های ملانوم Sk-Mel-28،
تحویل موثر نانو ذرات طلا در یک سیستم زنده به موانع بیولوژیکی طبیعی غالب مثل غشایی سلولی نیاز دارد. برای هدف گیری تومور خاص ،نانو ذرات طلا با چالش های دیگری از موانع بین توموری و تشخیص گیرنده مواجه است. روش بالقوه برای بهینه سازی تحویل نانو ذره کاهش اندازه ذره یا کسب تعدیل سطح است.
جایگاه اتصال آنزیم: بیشتر پپتید های بکاررفته برای تحویل نانو ذرات طلا هسته های سلول را هدف قرار می دهند. هسته یک هدف جذاب برای درمان فوتوترمی است زیرا حاوی دستگاه های ژنتیک سلولی است. این پپتیدهای نافذ به غشای هسته ورود نانو طلا را به هسته با اولین اجازه ورود در سلول از طریق RME بعد از مکان یابی هسته از طریق واکنش با کمپلکس روزنه هسته آسان می کند . بیشتر پپتیدهای نافذ به غشای هسته مشتق از منابع ویروسی هستند. . نمونه های معمول شامل پپتیدهای مکان یابی هسته ویروس Simian ، HIV1 ، پپتیدهای مشتق از پروتئین تات و پپتیدهای مشتق از پروتئین فیبر آدنوویروس. دیگر پپتیدهای با هدف هسته که بعنوان یک وسیله نقلیه برای نانو ذره عمل می کند شامل اشکال مختلف پپتید های RGD می باشد.
در شکل زیر نحوه اتصال به نانو ذرات طلا نشان داده شده است.

2-4 مطالعه سمیت نانو ذرات مغناطیسی:

برای اطمینان از بی خطر بودن یک سیستم نانو ذره مغناطیسی توسعه یافته برای استفاده، سمیت اجزا نانوذره به طور کلی باید تخمین زده شود. برای تخمین سمیت نانوذرات در نظر گرفتن دو چیز ضروری است. اول چگونگی برهمکنش نانوذرت موجود در بدن در طول مدت فعالیت و دوم بررسی چگونگی تاثیر ذرات مستقل در حین تخریب و یا پردازش های کبدی که به آن اعمال می شود.سمیت شناسی نانوساختارها برای بخشی از مطالعات ظاهر شده اند اما مطالعات بیشتری برای اطلاع از جزئیات پاسخ بدن به اجزای نانویی نیاز می باشد.

شکل 2-2: میزان مقاله های منتشر شده در مباحث سمیت نانوساختارها

نانو ذرات مغناطیسی در مقایسه با سایر نانوذرات بر پایه فلزات سنگین سمیت کمتری دارند و حتی در بعضی موارد غیر سمی در نظر گرفته می شوند در یک نمونه مطالعاتی دیده شد نانو ذرات که دارای جزئی از آهن فیزیولوژیک بدن می باشد، آهن اکسید موجود در آنها بوسیله پروتئین های فریتین،ترانسفرین و هموسیدرین متابولیزه و ذخیره می شود.

فصل سوم

روش شناسایی تحقیق(متدولوژی)

3-1 واکنشگرها :
واکنشگرها و مواد شیمیایی مورد استفاده در این پژوهش همگی با خلوص بالا و از شرکتهای معتبر تهیه شده اند.
هیدروژن تترا کلرو اورات (HAuCl4) از شرکت مرک (Merck) با کد شناسایی 101582 تهیه شده است.
سیستامین (Cysteamine) از شرکت فولیکا (Fluke) با کد شناسایی 30070 تهیه شده است.
تری سدیم سیترات (C6H5Na3.5H2O) از شرکت مرک (Merck) با کد شناسایی 106448 تهیه شده است.
تترا متیل آزنیوم
هیدروکسید (TMOH) از شرکت مرک (Merck) با کد شناسایی 108124 تهیه شده است.
کلرید آهن2 (FeCl2.4H2O) از شرکت سیگماآلدریچ (Sigma Aldrich) با کد شناسایی 380024 تهیه شده است.
کلرید آهن3 (FeCl3.6H2O) از شرکت سیگماآلدریچ (Sigma Aldrich) با کد شناسایی31232 تهیه شده است.

3-2 تهیه محلول ها:
محلول اولیه طلا با غلظت 0.1 درصد وزنی _ حجمی از حل کردن 0.1 گرم از
هیدروژن تترا کلرو اورات در بالن حجمی 100 میلی لیتر و به حجم رساندن با آب فاقد یون تهیه شده است.
محلول اولیه تری سدیم سیترات با غلظت 0.1 مولار از حل کردن 0.3 گرم از تری سدیم سیترات در بالن حجمی 10 میلی لیتر و به حجم رساندن با آب فاقد یون تهیه شده است.
محلول اولیه تترا متیل آزنیوم هیدروکسید با غلظت 5 میلی مولار از حل کردن 0.02 سی سی از (TMOH) در بالن حجمی50 میلی لیتر و به حجم رساندن با آب فاقد یون تهیه شده است.
محلول اولیه سیستامین با غلظت های 0.5، 0.1 و 0.05 از حل کردن به ترتیب 0.9 و 0.1 و 0.09 گرم از سیستامین در بالن حجمی 25 میلی لیتر و به حجم رساندن با آب فاقد یون تهیه شده است.
3-3 دستگاه ها :
طیف های جذبی با استفاده از دستگاه طیف سنجی UV-Vis ساخت شرکت Jasco ژاپن مدل v-530 با سل کوارتزی 1 سانتی متر ثبت شد طیف ها در محدوده 200 تا 800 ثبت شد.
دستگاه Inkubator1000 برای در مجاورت قرار گرفتن سیستامین با نانو ذره آهن پوشیده شده با طلا و هم خوردن آنها با هم مورد استفاده قرار گرفت.
همچنین برای سونیکیت شدن نانو ذره آهن از دستگاه اولتراسونیک ساخت شرکتBandelin مدل RK156.
دستگاه شیکر ساخت شرکت Hridolph آلمان مدل unimax 1010DT استفاده شد.
اسپکترو فتومتر FT-IR ساخت شرکت Jasco ژاپن مدل FT-IR410 استفاده شد.
ترازو با دقت0.0001 گرم ساخت شرکت Limited ژاپن استفاده شد.
میکر.سکوپ الکترونی TEM ساخت شرکت Philips هلند مدل CM30 مورد استفاده قرار گرفت.
آون ، ساخت شرکت Shimaz ، مدل Shimaz
هیتر مگنت، ساخت شرکت Alfa ، آلمان ، فرانکفورت مدل HS 860
حمام اولتراسونیک ، ساخت شرکت Bandelin، آلمان، بندلین، مدل RK 156
میکروپیپت مدل Boeco

3-4 روش تولید نانو ذره آهن:
برای تهیه ذرات نانو آهن نیاز به کمپلکس های FeCl2.4H2o و FeCl3.6H2o می باشد. ابتدا مقدار 2.307 گرم از FeCl3.6H2o را وزن کرده و همچنین مقدار 3.97 گرم از FeCl2.4H2o را وزن کرده و هر دوی این مواد را در یک بالن 100 میلی لیتر به حجم می رسانیم و در داخل یک بالن سه دهانه 250 میلی لیتر ریخته و بعد مقدار 7.47 میلی لیتر آمونیاک را به حجم 100 میلی لیتر رسانده و در قیف جدا کننده(دکانتور) ریخته و به بالن وصل نموده، در این روش نیاز به هم زن تفال یا شیشه ای می باشد( ما از مگنت استریر استفاده کردیم) گاز نیتروژن در طی واکنش وارد می شود و به مدت 2 ساعت در دمای 85 درجه این واکنش ادامه می یابد پس از اتمام زمان مورد نظر، 2 بار با آب مقطر و 2 بار با اتانول که در هر بار شستشو به کمک آهنربا عمل جداسازی انجام می شود و بعد از آن ماده در داخل آون در دمای 45 درجه گذاشته تا ذرات خشک شوند.

شکل3-1 سنتز نانو ذره آهن

3-5 روش پوشش دهی نانو ذره آهن با طلا:
0.01 گرم نانو ذره آهن

پایان نامه با واژگان کلیدی تغییر رنگ

را در 20 میلی لیتر آب دیس-پرس42 می کنیم و می گذاریم یک ربع ساعت در حمام سونیکه، سونیکیت شوند تا نانو ذرات مغناطیسی کاملا از یکدیگر جدا شوند. سپس 5 میلی لیتر از TMOH43، 5میلی مولار به آن از نانو ذرات فوق افزوده شد، و در دمای محیط به مدت دو الی سه ساعت روی همزن برقی گذاشته تا کاملا هم بخورد. سپس محلول سیترات سدیم 0.1 مولار به آن اضافه نموده و به مدت 2 الی 3 ساعت در دمای محیط روی همزن برقی گذاشته، سپس دمای محیط آزمایش را بالا برده تا آرام آرام به دمای 60 درجه سانتی گراد برسد. سپس محلول 0.1 درصد وزنی-حجمی از نمک طلا(HAucl4) تهیه شده را به محلول اضافه میکنیم پس از گذشت حدود نیم ساعت رنگ محیط به قرمز گرایید. پس از تغییر رنگ هیتر را خاموش نموده و اجازه داده شد تا آرام آرام محلول سرد گردد .نمونه فوق در محیط سرد(4درجه سانتی گراد) و در تاریکی به مدت طولانی قابل نگهداری است.

شکل 3-2 تصویر a محتوای نانو ذره آهن پوشش داده شده با طلا. تصویر b به دلیل وجود آهن ربا نانو ذرات آهن از محیط جذب آهن ربا شده اند.
3-6 روش مزدوج کردن سیستامین و نانو ذره:
نانو ذره آهن پوشش داده شده با طلا برای برقراری پیوند کوالانسی با سیستامین به دلیل داشتن گروه گوگردی در مجاورت هم قرار داده شد که در این تحقیق میزان غلظت، زمان و pH بهینه برای برقرای بهتر این پیوند مورد آزمایش قرار گرفت. در شرایط دمای طبیعی محیط در دستگاه شیکر در مدت زمانهای معیین و در دامنه ای از غلظت ها، نانو ذره آهن پوشش داده شده با طلا با سیستامین مزدوج شد.
3-7 روش محاسبه غلظت تقریبی نانو ذرات طلا:
برای محاسبه غلظت نانو ذرات طلا می توان از فرمول(1-3) استفاده کرد. این رابطه غلظت نانو ذرات را با فرض کروی و یکنواخت بودن اندازه بدست می آورد و از آنجایکه نانو ذرات دارای توزیع اندازه و شکل می باشند، غلظت بدست آمده تقریبی خواهد بود.

CAuNPs=

که در این رابطه MAu جرم مولکولی طلا،CAu غلظت یونهای Au3-، r قطر نانو ذرات طلا،Auρ چگالی طلا و A عدد آووگادرو است.

پایان نامه با واژگان کلیدی تحقیق و توسعه، علم و فناوری، فناوری نانو، نوع کاربری

مشاهده می شود برای مثال در نور خورشید سبز بنظر می رسد.این لیوان هنوز در موزه بریتانیا مشاهده می شود.

شکل 1-3 وجود رنگ قرمز و سبز در جام لیکورگوس به علت وجود نانو ذرات طلا و نقره در شبکه بلوری شیشه

نانوفناوری :
در فرهنگ واژه شناسی علم و فن‌آوری پیشوند نانو به معنای 000،000،1000/1 واحد می‌باشد، مثلاً nm 1 به معنای یک میلیاردم متر یا 9-10×1متر می‌باشد، مقیاس نانومتر یک مفهوم سه بعدی طبیعی برای مولکول‌ها و اثرات آن‌ها می‌باشد. در نانوفناوری ما با اشیاء یا موضوعات در مقیاس نانو سرو کار داریم. باید توجه داشت که خواص و عملکرد اشیاء در مقیاس نانو با چیزی که در ابعاد معمولی و بزرگتر وجود دارد، به مقدار قابل توجهی متفاوت می‌باشد. در گویش عمومی بحث علوم نانو، خواص مواد در مقیاس اتمی، ملکولی و ماکروملکولی را مورد بحث و بررسی قرار می‌دهد. در بحث صنعت نانو ما با طراحی، ساخت و بکارگیری تجهیزات، سامانه‌های با کنترل دشوار7و اندازه‌ی آن‌ها در مقیاس نانو سروکار داریم. ذرات نانو در رشته های گونانون مهم هستند، آنها در کل می توانند بصورت دو موضوع طبقه بندی شوند یعنی مهندسی شده و غیر مهندسی شده. نانو ذرات مهندسی شده عمدا با خواص فیزیکی ساخته شده طراحی و ایجاد می شوند تا نیاز کاربرد های خاص را برآورده کنند. آنها می توانند محصول را به خودی خود به پایان برسانند مثل در حالت نقاط کوانتومی، سنسور برای اهداف خاص یا آنها می توانند بخشی باشند که در محصولات نهایی جدا مانند کربن سیاه در محصولات لاستیکی گنجانده می شوند. در هر روشی خواص فیزیکی ذره برای عملکرد آنها یا کار محصولی که آنها در آن گنجانده می شوند خیلی مهم می باشند. از طرف دیگر، نانو ذرات مهندسی نشده بصورت غیر عمدی نانو ذرات تولید نشده می باشند مثل نانو ذرات اتمسفری ایجاد شده در طول احتراق. با نانو ذرات مهندسی نشده، خواص فیزیکی نیز نقش مهمی بازی می کنند بطوریکه آنها تعیین می کنند آیا تاثیر منفی در نتیجه وجود این ذرات روی می دهد یا نمی دهد

ذرات مغناطیسی مواد فاز جامد پاسخ دهنده به مغناطیس هستند که می توانند به شکل نانوذره منفرد یا تجمعی از ذرات میکرو و نانو باشند.هر کدام از انواع نانوذرات در زمینه خاصی استفاده می شوند.ترکیب،سایز و مسیر سنتز نانو ذرات مغناطیسی با توجه به نوع کاربری آنها متفاوت است اما ذرات سوپر پارامغناطیس، فرو و فری برای انواع کاربردهای دارورسانی قابل استفاده هستند. اینگونه مواد به دلیل گشتاور مغناطیسی واحد شبکه و ساختار دمین ها شدیدا از میدان مغناطیسی خارجی متاثر می شوندبه نحوی که در غیاب میدان مغناطیسی خارجی به صورت یک ذره غیر فعال عمل می کنند.
تک دمین بودن و سوپرپارامغناطیسی ازویژگی های نانوذرات مغناطیسی هستند که منشا بسیاری از خواص منحصر به فردشان می باشد. مطمئناً درک و کنترل خواصمغناطیسی نانوذرات، مکانیسم خواص ‏مغناطیسی مواد و طراحی و کنترل آن را روشن خواهدساخت. نانوذرات مغناطیسی، به دلیل کاهش ‏حوزه‌های مغناطیسی و در نتیجه ایجاد خاصیتسوپر پارامغناطیس آینده‌ی درخشانی دارند.

شکل 1-4 اندازه نسبی ذرات در مقیاس نانو در مقایسه با مولکول های دیگر

1-3 نانو ذرات :
نانوفناوری با توجه به اینکه بیشتر با ابعاد و شاخصه‌های مواد در ابعاد ریز بستگی دارد، این قابلیت را داراست، که در حوزه‌های مختلف علم و فناوری تاثیر گذار باشد. این پدیده به سرعت جایگاه خود را در تحقیق و توسعه باز کرده و تمامی زوایای مرز دانش و فناوری را تحت الشعاع خود قرارداده است. دامنه‌ی آن، از مواد و انرژی گرفته تا اطلاعات و ارتباطات، از اتم گرفته تا فضای لایتناهی را در بر می‌گیرد. نانوفناوری قبل از اینکه یک علم بین رشته باشد، بیشتر یک هنر یا صنعت ترکیبی است. با توجه به این مطلب نانوتکنولوژیست‌ها با ترکیب روش‌های مختلف ماکرو و میکروئی و بردن آن‌ها به ابعاد نانو خلاقیت‌های بسیاری را به کاربرده‌اند.

شکل 1-5 شکل های مختلف نانو ذرات که تا کنون شناخته شده اند

طبقه بندی نانو ذرات :
متدوال ترین نانو ذرات شامل نانو ذرات نیمه رسانا، سرامیکی، پلیمری و فلزی می باشند. بسیاری از سنتزهای ذرات نانوی کلوئیدی شناخته شده اند اما کار های انجام شده اخیر به سنتز ذرات نانو مخصوصا برای ساخت دستگاه ها و ساختارهای نانو اختصاص می یابد. این ذرات ممکن است شامل یک ماده خاص در یک اندازه خاص باشد یا اساسا سطح مشخصی داشته باشند. داشتن چند درجه کنترل بر شکل ذرات نانو ممکن است.پایداری ذرات نانو نیز یک نکته است، اقدامات احتیاطی خاص باید برای جلوگیری از انباشتگی یا رسوب آنها اتخاذ گردد. به علت اینکه در این تحقیق نانو ذرات فلزی مورد استفاده قرار گرفتند، بر روی این نانو ذرات به طور خاص تمرکز بیشتری می کنیم.
1-4-1 سوپر پارا مغناطیس:
خواص سوپر ‏پارامغناطیس نانو ذرات مستقیماً تحت تاثیر آنیزوتروپی مغناطیسی نانوذرات است.‏ هنگامی که ممان مغناطیسی نانو ذرات در جهت محور آسان بلور است، مقدار انرژی آنیزوتروپی ‏مغناطیسی (EA‏) کمینه می‌شود. در نانوذرات مغناطیسی کروی، آنیزوتروپی بلور مغناطیسی برابر باآنیزوتروپی ‏مغناطیسی کل است. این آنیزوتروپی به عنوان سدی برای تغییر جهت مغناطیسیاست. هنگامی که ‏اندازه نانوذرات تا حد آستانه‌ایی کاهش می‌یابد،‏EA‏ برابر با انرژی فعال‌سازی ‏گرمایی ‏‎(KBT)‎‏ می‌شود. با وجو
د سد انرژی آنیزوتروپی کوچک، جهت مغناطیسی نانوذرات به راحتی ‏توسط انرژی فعال‌سازی گرمایی ویا میدان مغناطیسی خارجی تغییر می‌کند. اگر انرژی گرمایی بیشتر ‏از ‏EA‏ باشد، تمام جهات و ممان مغناطیسی در جهات کاتوره‌ایی قرار می‌گیرند. اساساً رفتار کلی‏نانوذرات مغناطیسی مانند اتم‌های سوپر پارامغناطیس است. اگرچه نانوذرات هنوز خاصیتمغناطیسی ‏کمی دارند هر ذره مانند یک اتم پارامغناطیس عمل می‌کند، اما ممان مغناطیسی بزرگی دارد. چنین ‏رفتاری، سوپر پارامغناطیس نامیده می‌شود(شکل1-6). در ماده‌ی سوپر پارامغناطیس، جهت مغناطیسی نانوذرات به ‏جای جهت خاصی، سریعاً در حال تغییراست. دمایی که سد انرژی آنیزوتروپی مغناطیسی نانوذرات ‏همیشه بر اثرژی فعال سازی گرمایی غلبه می‌کند، دمای بلوکه نامیده می‌شود.

شکل1-6 ساختار مواد سوپر پارامغناطیس

1-4-2 نانو ذرات فلزی :
در سال 1857 مایکل فارادی8 اولین مطالعات اصولی را در زمینه سنتز و رنگ کلوئیدی طلا انجام داد[5]. او متوجه شد که رنگ قرمز نانو ذرات طلا به خاطر اندازه کوچک آنها می باشد، زیرا بر هم کنش این ذرات با نور در مقایس نانو با توده طلا متفاوت می باشد. اگر چه کارهای او بیشتر جنبه کیفی داشتند اما راه را برای بررسی بیشتر نانو ذرات فلزی و کاربردهای گسترده آن ها همواره نمود. از آن زمان هزاران مقاله علمی در زمینه سنتز، اصلاح9 بررسی خواص و تجمع نانو ذرات فلزی منتشر شده است که بسیاری از خواص فیزیکی و شیمیایی این ذرات که توجیه کننده ویژگی های رفتاری آنهاست را بیان میکند. امروزه نانو ذرات فلزی به طور گسترده در بیوشیمی، کاتالیز واکنش ها، حسگرهای زیستی و شیمیایی و در سیستم های نانو الکترونیک مورد استفاده قرار می گیرند [6,8]. .نانو ذرات حاصل از فلزات اصلی دیگر نیز ممکن است با احیاءآماده شوند مثل ذرات نقره حاصل ازAgNo3، پلادیوم حاصل از H2[PdCl4] و پلادیوم حاصل از H2[PtCl6]. [26,27] این شباهت ها در آماده سازی این کلوئید های فلزی مختلف، سنتز ذرات فلزی مخلوط شده را ممکن می سازد که امکان دارد اساسا با هر فلز دیگری فرق داشته باشد[29]. برای مثال، احیا یا کاهش ترکیبات نمک های فلزی اصلی می تواند منجر به تشکیل آلیاژ یا ذرات ریز مخلوط شود. جالب تر اینکه، ذرات مرکب می تواند در پوسته با سنتز یک هسته کلوئیدی کوچک بعد از بزرگ شدن آن با یک فلز متفات ساخته شود کلوئید طلا می تواند با نقره پوشیده شود. نانو ذرات فلزی با پوسته های مختلف مثل، گرافیت غیر فلزی، رسانا یا نیمه رساناCds پوشیده می شود.
ذرات مغناطیسی تحت یک میدان مغناطیسی خارجی می چرخند و به منظور جابجایی ذرات در یک جهت خاص از فضا باید از یک میدان ناهمگن استفاده شود.اثر نیروی مغناطیسی بر روی این ذرات در یک سوسپانسیون مایع با مغناطش ذرات،چگالی جریان مغناطیسی و گرادیان میدان مغناطیسی متناسب است.

شکل 1-7 اثر میدان خارجی بر ذرات مغناطیسی

خواص نوری نانو ذرات فلزی نظیر طلا و نقره بسیار قابل توجیه می باشد، که همین امر استفاده از آنها را در طول دهه گذشته افزایش داده است تحقیقات نشان می دهد تغییر رنگ این ذرات از تغییر در ترکیب، اندازه و شکل آنها ناشی می شود که در قسمت های بعدی درباره منشآ این رنگ به طور مفصل بحث خواهیم کرد.

شکل 1-8 نمونه هایی از نانو ذرات فلزی با شکل و اندازه مختلف، شکل سمت چپ تصاویر میکروسکوپ الکترونی عبوری10 نانو ذرات طلا کروی و میله ای (a,b) و نانو منشورهای نقره (c) و شکل سمت راست محلول کلوئیدی نانو ذرات آلیاژ طلا و نقره با افزایش غلظت طلا(d) نانو میله های طلا با افزایش نسبت ابعادی11 و نانو منشورهای نقره با افزایش اندازه جانبی را نشان می دهد[9]

1-4- 3 نانو مواد سه‌بعدی :
درخت‌سان‌ها
درخت‌سان‌ها مولکول‌هایی بزرگ و پیچیده‌اند، که ساختار شیمیایی کاملاً تعریف‌ شد‌ه‌ای دارند. از نقطه نظر شیمی درخت‌سان‌ها ماکرومولکول‌های نسبتاً کامل و یکنواختی (هم‌اندازه و هم‌شکل) هستند که دارای معماری سه‌بعدی منظم و به‌شدت شاخه‌شاخه می‌باشند. آن‌ها از سه بخش اصلی هسته، شاخه‌ها و گروه‌های انتهایی تشکیل شده‌اند. روش‌های ساخت آن‌ها بطور کلی به دو روش واگرا و هم‌گرا می‌باشد. به دلیل پیشرفت‌های اخیر در شیمی سنتزی و روش‌های تعیین مشخصات، توسعه سریع این نوع جدید از پلیمر‌ها ممکن شده است و ساخت انواع چارچوب‌های درخت‌سانی با ابعاد نانومتری تعریف ‌شده (3 تا 5 نانومتر برای نسل‌های بالا) و تعداد گروه‌های عاملی انتهایی مشخص عملی شده است. وگنل2، اولین مثال از یک روال سنتزی تکراری برای خلق ساختار‌های شاخه‌ای کاملاً تعریف ‌شده را در سال 1978 گزارش کرد. او این روال را «سنتز آبشاری» نامید. در اوایل سال‌ 1980 دنکوالتر سنتز درخت‌سان‌های مبتنی بر ال- لیزین را ثبت نمود. این اختراع ساختارهایی را تا پیچیدگی نسل‌های بالا معرفی می‌کرد. اولین ساختار‌های درخت- ‌وار‌ه‌ای که کاملاً مورد بررسی قرار گرفته، توجه زیادی را به خود جلب کرد و اخیراً کاربردهایی در پزشکی و دارورسانی برای آن‌ها مشخص شده است.
1-4-4 نانومواد دو بعدی:
غشاء‌های نازک
در دنیای کنونی تغییرات سطحی به یک فرایند مهم و اساسی تبدیل شده است. در این مورد روش‌هایی شامل ایجاد لایه‌های نازک یا پوشش‌ها بر روی سطوح است و این کار افزایش کارآیی و محافظت سطوح را به دنبال دارد. رسوب یک لایه نازک (نانولایه) برای پوشش‌ دهی در اکثر صنایع ج
ایگاه مهمی برای خود یافته است. نانولایه‌ها دارای یک ساختار نانو ذره‌ای می‌باشند که این ساختار یا از توزیع نانوذرات در لایه ایجاد می‌شود و یا به وسیله یک فرایند کنترل شده، در حین رسوب ایجاد می‌گردد. فیلم‌های نانویی لایه نازک، که بر روی سطح یک زیر پایه نشانده می‌شوند کاربردهای عمدتاً الکترونیکی دارند. همانند زیرلایه‌ها، خازن‌ها، قطعات حافظه، آشکارسازهای مادون قرمز و راهنماهای موجی.

1-4-5 نانو مواد تک بعدی :
چنانچه مواد را در یک بعد به مقیاس نانو در بیاورند ساختارهای تک‌ بعدی نانو خواهیم داشت، که خود قابل تقسیم بندی به گروه‌های زیرند.
1-4-6 نانولوله‌ها:
لفظ نانولوله در حالت عادی در مورد نانولوله‌های کربنی به کار می‌رود، هر چند که اشکال دیگری از نانولوله همچون انواع ساخته شده از نیترید بور یا حتی نانولوله‌های خودآرای آلی نیز وجود دارد. نانولوله‌ها با خواص مکانیکی، الکتریکی و اپتیکی برجسته، در مصارف الکترونیکی با بیشترین توجه روبه‌رو شده‌اند. همچنین نانولوله‌ها برای نگهداری هیدروژن و هیدروکربن‌ها جهت استفاده در پیل‌های سوختی نیز مورد مطالعه قرار گرفته‌اند. نانولوله‌ها نیز به دو گروه تک‌دیواره و چند‌ دیواره قابل تقسیم‌اند[20,21] .
1-4-7 نانومیله‌های طلا12:
در نانوفناوری نانو میله‌ها قطعاتی هستند با ابعاد یک تا صد نانومتر که در بسیاری موارد آن‌ها را با نانوسیم‌ها و یا نانولوله‌ها یکسان درنظر گرفته و مرز مشخصی برای آن‌ها قایل نمی‌شوند. نانو ذرات طلا میله ای شکل دو قله پلاسمونی دارند. یکی که حدود 530 نانو متر است پلاسمون تقاطعی 13 است و مربوط به ارتعاش الکترون ها اطراف محور کوچکتر میله است. دیگری که پیک قوی تری است و در طول موج بالاتری ایجاد می شود پلاسمون طولی 14 است و مربوط به ارتعاش الکترون ها اطراف محور طولی نانو میله ها است.(شکل 1-9 ). محل این پیک با تغییر اندازه ذره تغییر می کند (شکل 1-4).

شکل 1-9 نوسان طولی و عرضی الکترون ها در نانو میله های فلزی

شکل 1-10 پیک جذبی مرئی فرا بنفش نانو میله های طلا با نسبت ابعادی مختلف[27]

1-4- 8 نانوسیم‌ها:
سیم به ساختاری گفته می‌شود که در جهت طولی گسترش ابعاد یافته و در دو بعد دیگر کاملاً محدود شده باشد سیم‌های نانو دارای ویژگی رسانش الکتریکی و امکان اعمال اختلاف پتانسیل می‌باشند که آن‌ها را برای کاربردهای الکتریکی و سنجش زیستی بسیار مناسب ساخته است. مثال‌هایی از کاربرد نانوسیم‌ها عبارتند از: وسایل مغناطیسی، حسگرهای شیمیایی و بیولوژیکی، نشانگرهای بیولوژیکی و اتصالات داخلی در نانوالکترونیک مانند اتصال دو قطعه‌ی ابر رسانای آلومینیومی که توسط نانوسیم نقره صورت می‌گیرد.
1-4-9 نانومواد صفر بعدی:
نانوذرات یا نانومواد صفربعدی به گروهی از مواد نانوئی اتلاق می‌گردد که ابعاد آن‌ها در هر سه بعد نانوئی شده است. که خود مشتمل بر گروهای زیر می‌باشند.
1-4-10 نقاط کوانتومی:
نقاط کوانتومی یا نانوکریستال‌ها در دسته‌ی نیمه‌رساناها جای می‌گیرند. نیمه‌‌رساناها اساس صنایع الکترونیک جدید هستند و در ابزارهایی مانند دیودهای نوری و رایانه‌های خانگی به کار گرفته می‌شوند. اهمیت نیمه‌رساناها در این است که رسانایی الکتریکی این مواد را می‌توان با محرک‌های خارجی مانند میدان الکتریکی یا تابش نور تغییر داد، تا حدی که از نارسانا به رسانا تبدیل شوند و مانند یک کلید عمل کنند. این خاصیت، نیمه‌رساناها را به یکی از اجزای حیاتی انواع مدارهای الکتریکی و ابزارهای نوری تبدیل کرده است. نقاط کوانتومی، به خاطر کوچ

منبع پایان نامه با موضوع کودکان و نوجوانان، کودکان و نوجوان، اضطراب کودکان، احساس حقارت

ر از‌میزان همبودی اضطراب‌و اختلال درون نمود (مانند افسردگی) است و میزان آن بین 4/36? تا 7/16? متغیر است. (لست و همکاران، 1977). این نکته نیز قابل توجه است که اختلال‌های همبود تابع سن است. در واقع مطالعات نشان می‌دهد که همبودی اغلب در کودکان سنین بالاتر مشاهده می‌شود. (استاور اکیلی39 و همکاران، 1987؛ استرواس40 و همکاران، 1988).
همچنین‌میزان همبودی در میان انواع اختلال‌های اضطرابی متفاوت است مطالعه نشان داد کودکانی که تشخیص اولیه اختلال اضطراب جدایی را داشتند بیش از کودکان با تشخیص اولیه هراس اجتماعی یا اضطراب فراگیر، اختلال‌های همبود را نشان دادند. (ورداین41 و کندال، 2003). هراس خاص همبودی بیشتری را با اضطراب جدایی و اضطراب فراگیر داشته است تا با اضطراب جدایی، و به طور کلی در پسران بیش از دختران‌اختلال نقص‌توجه به‌اختلال لج‌بازی، نافرمانی با اختلال‌های همبودی داشته‌اند. با این وجود هنوز مشخص نیست که حضور اختلال‌های همبود چه تاثیری بر نتایج درمان دارد راپی42(2000) نشان دارد که نشانه‌های بدون همبود بر نتایج درمانی کودکان و نوجوانان با اختلال‌های اضطرابی تاثیری ندارد.

جدول 2-1 میزان شیوع اختلال‌های اضطرابی در کودکان و نوجوانان (بیدل و ترنر، 2005)

مطالعه و مکان آن
دامنه سن
تعداد آزمودنی
شیوع
آلمان

ایساو (2000) نیوزلند
12-7
1035
6/8?
اندرسن و همکاران 1977
11
782
4/7?
فرگوسن و همکاران 1993
15
961
8/12?
مک گی و همکاران 1990
15
943
1/10?
مک گی و همکاران 1992
18
930
4/12?
نیومن و همکاران 1996 ایالات متحده
21
961
2/20?
کاستلو و همکاران 1988
11-7
789
4/15?
کاستلو و همکاران 1988
18-12

7/17?
کاستلو و همکاران پس از 1994
13 و 11 و 9
4500
7/5?
کاشانی و همکاران 1987
16-14
150
7/8?

جدول 2-2 میزان همبودی نمونه‌هایی از کودکان که تشخیص اولیه اختلال اضطرابی داشته‌اند. (بیدل و ترنر 2005)
مطالعه
سن نمونه به سال
درصد کلی اختلال همبود
نوع و درصد اختلال همبود
ایسا و همکاران 2000
7-12
51
بدون همبود 49
اضطراب 48
افسردگی 2/30
بدنی شکل 6/39
سوء مواد 5/11
کینزبرگ و سیلورس 1996
نمونه اسپانیایی
نمونه سفید پوست
17-6

91
83

کندال و همکاران 2001
13-9
79
بدون همبود 21
اضطراب 7/49
بدون نمود 4/25
بدون همبود 33
سیلورمن و همکاران 2001
16-7
67
اضطراب 2/53
افسردگی 6/4
بدون نمود 4/25
بدون همبود 41
استرواس و همکاران 1988
17-5
60
اضطراب 31
افسردگی 28
دیدگاههای مختلف در مورد اضطراب
1. دیدگاه روان پویایی
در‌این دیدگاه شرایطی که موجب تشکیل خود و پس از آن فراخود می‌شود یک تجربه عاطفی دردناک به نام اضطراب ایجاد می‌کند. تشدید پاسخ‌های قلب و ریه و دیگر اندام‌های درونی تحت عنوان اضطراب ادراک و تجربه می‌شوند به طور کلی سه گروه اضطراب وجود دارد. اضطراب واقعی، عبارت است از احساس اضطراب از سوی‌دنیای بیرون‌اضطراب روان‌رنجورانه که محصول‌ترس از‌ابراز تکانه‌های وارسی نشده نهاد است که مشکلاتی را از سوی محیط ایجاد می‌کنند اضطراب اخلاقی، ترس از عدم رعایت معیارهای وجدان است. مشخصه این اضطراب‌ها منبع آنها است نه کیفیت آنها کار اصلی اضطراب این است که به خود هشدار می‌دهد برای رفع خطر و حفظ ارگانیسم باید اقداماتی انجام دهد (فیرس و ترال، ترجمه فیروز بخت و بهاری، 1383، به نقل از مهری نژاد ، 1379). فرویدی‌ها فرض اضطراب آغازین43 را نیز مطرح می‌کنند که علت آن ضربه تولد است. به طوری که طی آن کودک غرق در تحریکات محیطی می‌شود. اضطراب آغازین مبنای جسمانی وحشت است. که منظور از آن تهدید به غرق شدن در تحریکات غریزی هنگام بزرگسالی است. (پروچسکا و نورکراس، ترجمه سید محمدی، 1383) سند سترام44 و کرامر45 (2003) نشان دادند که بین اضطراب و نوع مکانیسم دفاعی کودکان نیز رابطه وجود دارد. به گونه‌ای که کودکانی که از مکانیسم دفاعی، ناپخته مانند افکار استفاده می‌کنند سطح بالاتر از اضطراب اجتماعی و نیز افسردگی را نشان می‌دهند.
2. دیدگاه زیست شناختی
طرفداران دیدگاه زیست شناختی معتقدند که اختلال در هیجان‌ها، رفتار و فرایندهای شناختی به علت نابهنجاری‌هایی در عملکرد بدن مانند مغز و سیستم عصبی یا سیستم درون ریز می‌دانند ساخت ژنتیکی فرد می‌تواند در تعیین برخی از اختلال‌ها نقش مهمی داشته باشند (هالجین و ویتسبورن،ترجمه سید محمدی، 1383).
بررسی‌نقش ژنتیک در‌اختلال اضطرابی‌نقش عوامل‌ارثی و معنی‌دار اما در حد متوسط نشان داده‌است براساس اطلاعات موجود نوعی اختلال اضطراب در دوران بزرگسالی یعنی‌اختلال هراس، تقریبا‌در یک چهارم‌وابستگان نزدیک بیمار به هراس دیده می‌شود، حال آن که این میزان در گروه گواه 2? است (کراو46 و همکاران، 1993) پژوهش روی دوقلوها نشان داد که 31? دوقلوهای یک تخمکی هر دو به اختلال هراس مبتلا بوده‌اند در حالی که هیچ یک از دوقلوهای دو تخمکی به این اختلال دچار نبوده‌اند به نظر می‌رسد که هراس‌های ساده نیز در بین افراد خانواده شخص مبتلا وجود دارد. (فیر47 و همکاران، 1990) در مقابل نتایج پژوهشی نشان می‌دهد که در اختلال اضطراب فراگیر عوامل ارثی نقش اندکی دارند. (کندلر48 و ال49، 1992) الگوهای زیستی عامل پژوهش‌هایی هستند که در‌آنها سعی می‌شود آسیب‌های زیستی را که علت اختلال‌های اضطرابی در نظر گرفته می‌شود بیابند به
نظر می‌رسد که اضطراب نابهنجار ناشی از آسیب با بدکاری زیستی باشد تا حوادث و آسیب‌های روانی (بلک برن و دیوید سن، ترجمه توزنده جانی، 1374).
دیدگاه سالیوان50
سالیوان به عنوان یکی از نظریه پردازان برجسته نوفروید گرایی شکل گیری و رشد اضطراب را به میزان قابل توجهی به دوران کودکی می‌داند.
به تصور سالیوان، اضطراب در طفل و از آشفتگی روابط بین مادر و طفل سرچشمه می‌گیرد‌او اضطراب‌را عامل‌عمده‌ای در‌رشد شخصیت‌و نیز‌در پیدایش‌تمام بیماری‌های هیجانی ویسیکو پاتولوژی تلقی می‌کند (راو، ترجمه وهاب زاده، 1366 ،به نقل از متین ، 1383).

دیدگاه هورنای51
هورنای ریشه‌ی اضطراب‌ها را در برخوردهای والدین با کودک ترسیم نموده و شکل گیری اضطراب در شخصیت را متاثر از این برخورد می‌داند، بدین معنا که عادات کودک در اتکاء به والدین می‌تواند زمینه سازی برای تکوین شخصیتی وی در آتی گردد. وی می‌نویسد:
مهمترین‌عاملی که بیش از هر‌چیز موجب‌اضطراب و تشویش کودک می‌گردد. احساس سوء ظن و بد گمانی است که نسبت به اطرافیان خود پیدا می‌کند بچه احساس می‌کند که در محبت و دوستی توجه و مراقبت والدین نسبت به خود صداقت وجود ندارد و جز تظاهر و ریا چیز دیگری نیست. البته مقداری از این احساس بی اساس است و ناشی از‌ضعف طبیعی کودک می‌باشد اما‌در حقیقت علت عمده آن تلون مزاج در رفتار متضاد و تفسیر پدر و مادر نسبت به کودک است (هورنای، ترجمه مصفا، 1368، به نقل از مهری نژاد ، 1379).
هورنای بر اصل اضطراب بنیادی52 تأکید و بیم و احساس ناامنی در کودک را ناشی از روابط او‌با والدین می‌داند که به‌صورت اغماض بیش از اندازه، سلطه جویی، بی ثباتی و بی تفاوتی نسبت به او عمل می‌کند. در نتیجه طفل بدون احساس تعلق به کسی به حال خود رها می‌شود و تخاصم و تعارض از این اضطراب بنیادی مشتق می‌شود (راو، ترجمه وهاب زاده، 1366،به نقل از متین ، 1383). شرایط نامناسب و ناهنجار موجب می‌شود که کودک از رشد طبیعی خود منحرف گردد و نتواند استعدادها و امکاناتی که بالقوه در او هست پروش دهد.
شرایط ناهنجار مانع رشد‌عبارتند از‌ تحقیر اجحاف و تعدی و زور و فشار، عدم رعایت احتیاجات خاص کودک، بی علاقگی و بی توجهی به او، تبعیض بین بچه‌ها، ایجاد محیط ناامن، سختگیری بیش از حد، ایراد و انتقاد و بهانه جویی بی مورد، زیادی از بچه‌ها مواظبت و حمایت کردن، فقدان محبت صادقانه که اینها از مهمترین عوامل و شرایطی است که مانع رشد طبیعی و سالم کودک می‌گردد. و یک احساس ناایمنی، اضطراب، تشویش و دلهره دائمی در او ایجاد می‌نماید. اضطراب و تشویشی را که بدین طریق بوجود می‌آید. من “اضطراب اساسی” می‌نامم (هورنای، ترجمه مصفا، 1368، به نقل از مهری نژاد ، 1379). به زعم هورنای اضطراب اساسی شکل یافته در ایام کودکی در فعالیتهای اجتماعی انسان تاثیر گذاشته و این امر به نوبه خود می‌تواند منجر به تولید هراس و اضطراب گردد.

دیدگاه اتو رنک
اتو رنگ شروع و شکل گیری اضطراب را در اوان نوزادی در زمان تولد می‌داند به اعتقاد وی اضطراب با جدایی از مادر مربوط است بخصوص جدایی از رحم که تامین کننده رضایت بدون تلاش است. این تجربه دردناک منجر به اضطراب اولیه می‌گردد. (پورافکاری، 1368، به نقل از یوسفی لویه ، 1386)
فرا یند تولد در پاسخ به احساس بی گناهی، موجب اضطراب اولیه است و جدایی از مادر اساسی‌ترین ضربه و یک تغییر ناگهانی و خشن از محیط امن داخل رحمی به دنیای بی ثبات خارج است زمانی که طفل آگاه می‌شود که موجودی از مادر جداست دچار تعارض می‌شود و آرزو به جدایی، منجر به احساس گناه می‌شود. (وهاب زاده، 1366، به نقل از متین ، 1383)

دیدگاه آدلر53
آدلر به‌عنوان پیشگام روان‌شناسی فردی، اضطراب‌را نشات‌گرفته از احساس حقارت54 دانسته و‌تعارض فرد را در جهت فائق شدن بر این احساس، ریشه اضطراب و نوروز می‌پندارد (ریکمان55، 1989) در این خصوص می‌نویسد:
آدلر اعتقاد دارد که افراد نوروز کسانی هستند که احساس شدیدی در احساس کهتری و حقارت داشته و برای جبران این امر، سعی می‌کنند که به اهداف والایی که آنها اعتقاد دارند از این طریق خودشان را در احساس برتری شخصی‌شان بر دیگران ثابت کنند و دست یابند.
“از دیدگاه مکتب روان شناسی فردی منش فرد روان نژند اغلب با اضطراب همراه است اضطراب یک خصوصیت فوق العاده گسترده و همه گیر است و از همان روزهای اول کودکی تا سنین پیری با کودک همراه است اضطراب زندگی فرد را تا حد زیادی تلخ می‌کند و او را از تمام تماس‌های انسانی باز می‌دارد. و امید او را به انجام یک زندگی آرام نابود می‌کند.” (شفیع آبادی و ناصری ،1365)
دیدگاه رفتاری
روان شناسان رفتارگرا، بر نقش رویدادهای خوشایند و سوابق یادگیری فرد و نیز نقش محیط اجتماعی و بین فردی فعلی به مثابه نیروهای دخیل در رفتار انطباقی و نیز غیر‌انطباقی تاکید دارند، الگوی‌رفتاری بر‌رفتار قابل‌مشاهده کودک و‌عوامل محیطی نگهدارنده آن تاکید می‌کند. به اعتقاد رفتارگرایان وقتی سایر عوامل موثر ثابت است، تفاوت‌های موجود میان کودکان ناشی از یادگیری است. الگوهای رفتاری بهنجار یا نابهنجار، تا حد زیادی تحت تاثیر محیط فعلی است و تغییر در عوامل محیطی، الگوی رفتاری را تغییر می‌دهد. (کندال، ترجمه نجاریان، داوودی، 1384). برای نمونه شمیر56 و همکاران (2005) در پژوهشی نشان دادند که کودکان مضطرب، مادران مضطرب دارند و بر‌نقش عوامل‌محیطی تاکید داشتند و‌همچنین ویلیا
سون57 (2005) در پژوهشی که روی 20 کودک مضطرب 12-6 ساله‌انجام داد به اثر رویدادهای پر تنش خصوصا رویدادهایی که خارج از کنترل کودک بودند در بروز اضطراب پی بردند.

دیدگاه شناختی
دیدگاه شناختی تاکید می‌کند که عملکرد شناختی در ناراحتی هیجانی یا رفتاری موثر است. سوء تعبیر موقعیت‌های اجتماعی، تمایل به تفکر منفی بدون وجود داده‌های کافی، عادت به سرزنش نابجای خود به دلیل بدبیاری‌ها، مثال‌هایی از پردازش‌های شناختی غیر کارکردی58 هستند (کندال، ترجمه نجاریان و داوودی، 1384).
در واقع‌آنچه مسئول ایجاد هیجان‌های منفی از قبیل اضطراب، خشم و یا غمگینی است خود‌رویدادها نیستند بلکه انتظار و تفسیر افراد از آن رویداد است دراضطراب تفسیر یا دریافت‌های شناختی مهم به خطر فیزیکی و یا روانی- اجتماعی، ارتباط می‌یابد در این موقعیت‌ها ادراک افراد اغلب ارزیابی‌هایی غیر واقع نگرانه‌ای از تهدید را تشکیل می‌دهند امالک (1976) استدلال می‌کند که در حالت‌های اضطرابی افراد مرتبا خطر متعلق به موقعیتی خاص را بیش از آنچه واقعا وجود دارد برآورد می‌کنند این گونه پیش برآوردها به طور خودکار و به طور غیر ارادی “برنامه اضطرابی” را فعال می‌سازند. منظور از “برنامه اضطراب” مجموعه‌ای از پاسخ‌ها هستند که از راه تکامل زیست شناختی به ما رسیده‌اند. این پاسخ‌ها در اصل برای محافظت ما از آسیب‌های مربوط به محیط ابتدایی طراحی شده‌اند (کرک و کلارک، ترجمه قاسم زاده، 1385).
بنابراین اضطراب پیامد نامناسب شناخت‌های غیر منطقی است، زمانی که رویدادهای بی شماری را بررسی می‌کنیم که افراد خود را به خاطر آنها مضطرب می‌کنند، متوجه می‌شویم که شناخت‌های غیر منطقی چه قدر گسترده هستند. والدین در مورد مسائل جنسی فرزندان‌شان بی اندازه نگران می‌شوند این نوع اضطراب‌ها را با مقابله کردن با افکار نامعقول که فرد درباره‌رویدادهای محرک دارد، می‌توان‌خاموش کرد (بروچسکا و نورکراس، ترجمه سید محمدی، 1383).
سیلورمن (2008) با‌مطالعه بر‌روی کودکان‌12-7 ساله‌نشان داد‌که بیشترین نگرانی‌های مشترک کودکان به موضوع مدرسه، سلامتی و آسیب شخصی مربوط است. هر چند که تفاوت‌های وابسته به سن در اینها کمتر مشاهده شد ولی در مجموع دختران نسبت به پسران نگرانی‌های بیشتری را اظهار می‌کردند همچنین نتایج نشان داد که اضطراب کودکان با نگرانی آنها رابطه معنی دار دارد و نیز در پژوهشی نشان داد که خودگویی کودکان بسیار مضطرب در رویارویی با موقعیت‌ها، با باورهای منفی آنها همبستگی مثبت دارد.
فرایند‌ارزیابی شناختی به کودک کمک می‌کند که به محرک محیطی و درونی معنا بدهد. هنگامی که فرایند شناختی بوسیله احساس فراگیر تهدید در رویارویی با چنین محرک‌هایی تفسیر شد نتیجه می‌تواند ترس یا اضطراب باشد. اضطراب غیر انطباقی متضمن فرایند‌شناختی تحریف‌شده مقابل‌فرایند شناختی ناقص می‌باشد. (کندال، 1985، به نقل از یونسی و شیری، 1384).
کودکان مضطرب افکار مشوش‌ و نگرانی‌های شدیدتری درباره جدایی و موقعیت‌های اجتماعی دارند و همچنین موقعیت‌های مبهم را بیشتر از کودکان عادی تهدید آمیز تفسیر می‌کنند( شارت و همکاران ،2001، بهنقل از یوسفی لویه ، 1386). مارین59 (2004) نیز در پژوهشی روی 193 کودک کلاس 5 و 6 نشان دادند که افکار مضطرب کننده مانند تهدید و تردید نشانه‌های اضطرابی‌بیشتری را پیش‌بینی می‌کنند. همچنین کودکان مضطرب و مادرانشان شرایط مختلف را بیشتر‌از افراد‌عادی تهدید‌آمیز تفسیر می‌کنند. به‌عبارت دیگر‌بر طبق‌نظریه‌های شناختی اضطراب، نقش برجسته‌ای

منبع پایان نامه با موضوع کودکان و نوجوانان، کودکان و نوجوان، اضطراب کودکان، مواد مخدر

اسهال، احساس سر گیجه و سبکی در سر، تعریق مفرط، تشدید رفلکس‌ها، بالا رفتن فشار‌خون، تپش قلب، احساس‌درد در قفسه سینه، اتساع مردمک، بیقراری و قدم زدن، سنکوب، مور مور شدن اندامها، لرزش، آشفتگی معده، بی خوابی، اشکال در تمرکز حواس، بی حالی، بی اشتهایی، تکرر ادرار و احساس قریب الوقوع بودن دفع ادرار علاوه بر آثار حرکتی و احشایی اضطراب، تاثیر آن در تفکر، ادراک و یادگیری نباید از نظر دور بماند، اضطراب پیدایش گیجی، کونفوزیون16 و دگرگونی ادراک را نه تنها در ارتباط با زمان و مکان بلکه افراد و معانی حوادث، تسهیل می‌کند. این دگرگونی‌ها با پایین آوردن سطح تمرکز، کاهش فراخوانی خاطرات و ایجاد اختلال در توانایی ربط دادن یک عبارت به عبارت دیگر (تداعی) در یادگیری ایجاد تداخل می‌کند. یک وجه مهم هیجان‌ها، تاثیر آنها بر انتخابی بودن توجه است بیمار مضطرب مستعد انتخاب بعضی از اقلام در محیط خود و چشم پوشی از اقلام دیگر بوده و به این ترتیب سعی می‌کند ثابت کند که در ترسناک تلقی نمودن یک موقعیت و ابراز واکنش متناسب با آن حق‌دارد اگر او اشتباهاً ترس‌‌های خود را توجیه‌نماید اضطراب‌های وی بوسیله واکنش انتخابی شدت خواهد یافت. به این ترتیب حلقه‌ای معیوب از اضطراب، دگرگونی ادراک، افزایش اضطراب بوجود خواهد آمد. از طرف دیگر، اگر او با فکر انتخابی اشتباها به خود اطمینان ببخشد اضطراب‌های متناسب ممکن است فروکش نموده و او را از اقدامات احتیاطی لازم باز دارد. (کاپلان ، سادوک ، ترجمه پور افکاری، 1382)

ترس
ترس یکی از‌هیجان‌های بنیادی‌است که معمولا‌به عنوان واکنشی به‌اشیا یا موقعیت‌های تهدید کننده امنیت جهانی یا بهزیستی هیجانی در نظر گرفته می‌شود (بیدل، ترنر، 2005).
هیجان ترس هشدار دهنده است و با فعال کردن دستگاه عصبی خود مختار که با حالت‌های فیزیولوژیک مختلفی مثل عرق کردن، لرزیدن، تنیدگی عضلانی. ناراحتی معده‌ای، روده‌ای، نفس نفس زدن، تپش قلب نمود می‌یابد. شخص را آماده‌ی پاسخ “جنگ یا‌گریز” می‌کند یعنی‌یا شخص‌می‌جنگد یا‌می‌گریزد (بارلو،‌چورپیتا و تارووسکی 1996، به نقل از شروردن و گوردن، ترجمه‌ی فیروز بخت، 1384) ترس اغلب برای اشاره به واکنش طبیعی به یک تهدید واقعی یا ادراک شده به کار برده می‌شود. برای مثال ممکن است در کودکی ترس از مطب دندان پزشکی به دلیل درد واقعی که در ضمن کشیدن دندان احساس شده بوجود آید. (چویل و موریس، ترجمه نائینیان و همکاران، 1381). این‌پاسخ‌ها با از‌بین رفتن‌تهدید واقعی یا‌ذهنی محو می‌شوند. ترس یک واکنش انطباقی است و شخص به تجربه یاد می‌گیرد تهدیدهای واقعی را از محرک یا وضعیت‌های بی خطر تشخیص بدهد. رشد شناختی هم بر ادراک و برداشت شخص از تهدید تاثیر می‌گذارد (شرودر و گوردون، ترجمه فیروز بخت، 1384). با این وجود در پیشینه اختلال رفتاری/ آسیب روانی کودک از اصطلاح ترس گاه به عنوان واکنش رشدی بهنجار و گاه به عنوان مشکلی بالینی استفاده می‌شود (کسلر17 1972، لیپمن18 1967، به نقل از چویلی و موریس، ترجمه نائینیان و همکاران، 1381). مطالعات متعددی نشان می‌دهد که بین سن و ترس از اشیا و رویدادها رابطه وجود دارد به گونه‌ای که به طور کلی به موازات افزایش سن، ترس‌های گوناگون کاهش می‌یابد. ( بیدل و ترنر، 2005)
انواع ترسهای دوران کودکی
اضطراب عادی و لازم در کودکان:
از نوپایی تا نوجوانی هر فردمی‌تواند با بحران‌هایی مثل تکیه بیش از اندازه بر والدین مقاومت در برابر تغییر کاهش اعتماد به نفس روبرو شود.
نوعاً این نگرانی‌ها حل می‌شوند وقتی که کودک یاد بگیرد که موقعیت را اداره کند (سر رشته کار را در دست بگیرد). هماهنگ کردن توانایی‌های جدید، مثل نام نویسی در یک مدرسه جدید، همسایگان جدید، امتحان دادن، مواجه با سگها، بچه‌ها از ترسهایشان فاصله می‌گیرند و دیگر احساس بد حالی نمی‌کنند (کیم برلی، 2007).

نوزادی
کودک هنگام مشاهده افراد نامأنوس ( افرادی جز پدر و مادر) معمولاً به والدین می‌چسبد و جیغ می‌زند. این ترس‌ها تا 9-7 ماهگی نهایتا یک سالگی برطرف می‌شود. (کیم برلی، 2007)

اوایل کودکی
اضطراب جدا شدن از پدر و مادر (جدا کردن اتاق کودک) که علائم گریستن، اندوه، ترس از دست دادن مهر والدین و…. را دارد تا یک سال ممکن است ادامه یابد و نهایتا طی 3 سال از بین می‌رود. همین که دنیای کودکان وسعت می‌یابد (مثلا ورود به مهد) آنها ممکن است موقعیت‌های جدید و ناآشنایی را تجربه کنند آنها ممکن است از سگها و عنکوبتها بترسند.
کودکان 6-3 ساله سعی می‌کنند که بفهمند چه چیزهایی واقعی و چه چیزهایی غیر واقعی‌هستند .آنها ممکن است از کمد و دستشویی، زیر تخت، تاریکی و…… بترسند( به دلیل خلق محرکهای غیر واقعی، مثل هیولا)، وقتی کودک بتواند درک کند که خیلی از چیزها وجود خارجی ندارد توانایی‌اش برای تنها خوابیدن افزایش می‌یابد (کیم برلی، 2007).

کودک مدرسه‌ای
هر سال کودکان دبستانی اطلاعات جدیدی را به دست می‌آورند آنها خطرات دنیای واقعی، دزدی، طوفان، بیماری یا مواد مخدر را درک و می‌فهمند که این خطرات وجود دارند ولی از او دورند . و به او نزدیک نیستند.
در مدرسه راهنمایی رشد اجتماعی آنها شکل می‌گیرد و نگرانی‌های اجتماعی هم برای جامعه پذیری در آنها بوجود می‌آید. نگرانی راجع به ادامه تحصیل، عملکرد اجتماعی و‌شناسایی گروههای‌اجتماعی، یک نگرانی‌عادی است آگاهی‌از انواع بیماریهای جسمی
و روانی می‌تواند موجب نگرانی او شود نوجوانان در مورد گروههای همسالشان، دنیای بزرگتر، قوانین اخلاقی و موفقیت آینده‌شان نگران هستند.
نگرانی
سازه “نگرانی” درک دو مفهوم ترس و اضطراب را برای ما سخت‌تر می‌کند، سازه نگرانی‌از این جهت‌مهم است که نگرانی یکی از مداخله‌های اصلی اختلال‌های اضطرابی کودکان در ویراست چهارم راهنمای تشخیص و آماری اختلال‌های روانی (DSM-IV) است. نگرانی جزو مولفه‌های شناختی اضطراب است برخلاف اضطراب که پاسخ هیجانی پیچیده‌ای است و مولفه‌های شناختی، فیزیولوژیک و حرکتی دارد (بارلو 2002؛ واسی و دالایون 1994 هر دو به نقل از شرودر و گوردن، ترجمه فیروز بخت، 1384). نگرانی، افکار و تصورات، در رابطه با پیامدهای منفی و تهدید آمیز است. کنترل این افکار و تصورات سخت است و می‌تواند عذاب آور باشند، همان طور که ترس یکی از حالت‌های دستگاه هشدار شناختی است که ما را وامی‌دارد خطرات آتی را پیش بینی کنیم در نگرانی، رویدادهای آزارنده را مرور می‌کنیم و راه‌های اجتناب از آنها کنار بیاییم. این حل مساله یکی از فواید انطباقی نگرانی است چون ما را آماده می‌کند با وقایع مواجه شویم و با آنها کنار بیاییم. اما اگر در این زمینه افراط کنیم عملا فرایند مساله مختل می‌شود (میتوز، 190، به نقل از شرودر و گوردن، ترجمه فیروز بخت، 1384). مطالعات تجربی اخیر از این فرضیه که نگرانی و اضطراب کودکان دو سازه به هم مرتبط اما مستقل هستند، حمایت می‌کنند. (موریس و همکاران، 1998، سیلورس و همکاران 1995، به نقل از شرودر و گوردن، ترجمه فیروز بخت، 1384).

ترس در برابر اضطراب
ترس و اضطراب هر دو با مضمون تهدید مرتبط هستند ترس یک واکنش مشخص به محرک‌های معین‌تلقی می‌شود و‌اضطراب یک‌واکنش منتشر‌تر و‌درونی‌تر است (گراهام، ترجمه‌ی محمدی و هاشمی کهن زاد، 1381). همچنین در ترس به جای تنیدگی و بیمناک شدن، پاسخ فیزیولوژیک واکنش هشدار را‌بروز می‌دهیم با توجه به این که ترس و اضطراب دو سازه فرضی هستند و از گزارش‌های خود شخص، باز بینی‌های فیزیولوژیک و مشاهدات رفتاری استنباط می‌شوندو و خصایص مشترک زیادی دارند، در این مورد که آیا دو سازه متفاوت هستند یا تظاهرات سازه کلی ‌تر و پراکنده‌تری به نام عاطفه منفی اختلاف نظر هست .(آلبانو، کازی و کارتر، 2001، به نقل از شرودر و گوردن، ترجمه فیروز بخت، 1384).
ترس و اضطراب مثل سایر هیجان‌ها سه مولفه متمایز اما بسیار مرتبط دارند: 1) واکنش‌های حرکتی یا رفتاری مثل اجتناب، گریز، بازخورد توام با تردید، گریه، روی هم فشردن فک‌ها، کمک خواستن، مناسک قدم زدن و عدم تحرک، 2) واکنش‌های شناختی یا ذهنی شامل افکار، تصورات، باورها و اسنادها و پیامدهایی مثل ناراحتی و وحشت، 3) واکنش‌های فیزیولوژیک مثل افزایش ضربان قلب، زیاد عرق کردن، تند نفس کشیدن، تنیدگی عضلانی، ناآرامی، اختلال خواب و عدم تمرکز حواس (باریوس و هارتمن 1997، به نقل از شرودر و گوردن، ترجمه‌ی فیروز بخت، 1384).
علائم عمومی اضطراب در کودکان
1. علائمی مثل گریستن، علائم فیزیکی، اندوه، خشم، بیچارگی، ناامیدی و شرمندگی.
2. به راحتی در موقعیت‌های اضطراب‌زا مضطرب می‌شوند.
3. مدام سوالاتی می‌کنند، خیالشان راحت شود مثلا چی میشه اگر……؟
4. دلداری ناپذیرند.
5. به بحث‌های منطقی پاسخی نمی‌دهند. بحث‌های منطقی را قبول نمی‌کنند.
6. سردرد، دل درد، به طور مرتب مریضند که به مدرسه نروند.
7. به طور مرتب مضطربند، ساعتها نگران هستند روزها، هفته‌ها.
8. از خواب می‌پرند، به سختی به خواب می‌روند، به طور مرتب کابوس می‌بینند. به سختی قبول می‌کنند تنها بخوابند.
9. کمال گرا هستند. خودشان را دائما زیر سوال می‌برند. استانداردهای خیلی بالایی دارند. طوری که هیچ چیز را کامل نمی‌دانند.
10. با مدرسه رفتن مشکل دارند.
11. عملکرد خودشان یا خانواده را ضعیف می‌کنند با مدرسه رفتن مشکل دارند، در رفت و آمد با دوستان و فعالیتهای روزانه، اجتماعات خانوادگی مشکل دارند.
12. والدین‌باید وقت‌زیادی را‌برای آرامش‌دادن به کودک حتی در موقعیت‌های استرس‌زای عادی مصرف کنند باید برای انجام کارهای بهداشتی، تکالیف مدرسه، خوردن غذا، مدام نوازش کنند یا با آنها صحبت کنند (چانسکی، 2008).
اختلال‌های اضطرابی در کودکان
اضطراب معمولا با افسردگی همراه است کسانی که اضطراب دارند اغلب از نگرانی فزاینده، خجالت بارز، علائم افسردگی، توهم شکایت می‌کنند. (هاروی پارکر19، 2008).
در DSM- IV کودکان با یکی از 9 اختلال اضطرابی تشخیص داده می‌شوند: اختلال اضطراب جدایی، اختلال وحشتزدگی هراس از مکان‌های باز، اختلال اضطراب فراگیر (اختلال‌اضطراب مفرط)، هراس‌اجتماعی، هراس‌خاص (ساده)، اختلال وسواس فکری- عملی، اختلال فشار روانی پس از سانحه و اختلال فشار روانی حاد و در همه این اختلال‌های اضطراب یک مشخصه مشترک است که به صورت واکنش‌های شناختی ویژه و‌ناپیوسته، واکنش‌های فیزیولوژیکی و رفتاری بروز می‌کند، آنچه که یک اختلال اضطرابی را از دیگر اختلال‌ها متمایز می‌کند کانون اضطراب کودک است. (ماش و بار کلی، ترجمه‌ی توزنده جانی، توکلی زاده، کمال پور، 1383).

اختلال اضطراب جدایی:20
مشخصه اصلی اختلال اضطراب جدایی، ظاهر شدن اضطراب بیش از حد در مورد جدایی از کسانی است که کودک به آنان دلبستگی دارد. (انجمن روانپزشکی آمریکا 1987 به نقل از هربرت، ترجمه فیروز بخت، 1384).
کودک مبتلا به
اضطراب جدایی برای آن که نزدیک مادر یا کسی که به او دلبستگی دارد بماند از مدرسه رفتن طفره می‌رود، سردردها، دل دردها و سایر نشانه‌های جسمانی در این کودکان دیده می‌شود. تشخیص اضطراب جدایی وقتی مطرح می‌شود که از حد بهنجار فراتر رود. (هربرت، ترجمه فیروز بخت، 1384). این اختلال باید حداقل، مدت 4 هفته دوام داشته باشد. پیش از 18 سالگی شروع شود و باعث ناراحتی و اختلال قابل توجه در عملکردهای اجتماعی تحصیلی (یا شغلی) و سایر زمینه‌های مهم گردد. افرادی که این اختلال را دارند ممکن است بر اثر جدایی از خانه یا از افرادی که به آنان دلبستگی زیاد دارند دچار ناراحتی شدید و مداوم ‌شوند این افراد وقتی از مظاهر اصلی دلبستگی جدا می‌شوند اغلب ترس‌های مربوط به تصادف و بیماری افراد مورد علاقه و یا خودشان اشتغال فکری پیدا می‌کنند. کودکانی که این اختلال را دارند اغلب ترس از گم شدن و گم کردن همیشگی والدین را بروز می‌دهد. وقتی به تنهایی در خارج از منزل و سایر مکان‌های آشنا سفر می‌کنند احساس ناراحتی کرده و ممکن است. از سفر به تنهایی خودداری کنند ممکن است در رفتن به مدرسه، اردو رفتن و رفتن به خانه یک دوست یا گذراندن شب در آنجا یا سفر کوتاه مدت تمایل نشان ندهند و یا خودداری می‌کنند.
این کودکان ممکن است تمایل به تنها ماندن در یک اتاق را نداشتند و حالت چسبندگی یا کنده شدن را داشته باشند و به والدین خود بچسبند (انجمن روان شناسی آمریکا DSM-IV، آوادیس یانس و نیکخو، 1381).
با وجود این که مفهوم کمرویی جدید نیست، تنها در سال‌های اخیر اختلال اضطراب جدایی به عنوان یک اختلال شدید و شایع شناخته شده است که بر کارکردهای هیجانی و اجتماعی کودک اثر می‌گذارد. علاوه بر اینکه می‌تواند به آسیب‌های شدیدی در گستره زندگی منجر شود از جمله این که داده‌های جمع آوری شده در بریتانیا به طور تلویحی نشان می‌دهد که اضطراب جدایی در کودکی مقدمه اختلال اضطراب هراس از مکان‌های21 باز در دوران بزرگسالی است. (سیلور22 و همکاران، 1995، به نقل از کندال، ترجمه‌ی نجاریان و داوودی، 1384).

اختلال وحشتزدگی23
اختلال‌وحشتزدگی با‌وقوع حداقل یک حمله وحشتزدگی غیر منتظره یک ماه (یا بیشتر) با هم فاصله دارند، تعریف می‌شود، تشخیص اختلال وحشتزدگی در کودکان ممکن است به خاطر محدودیت‌های شناختی- رشدی کودک دشوار باشد. کودکان خردسال بدون توجه به نشان‌های خود مختار و تفسیر نادرست این نشانه‌ها ترس از مریض شدن را گزارش می‌دهند. از نظر بالینی، کودکان قبل از دوره بلوغ تقریبا هرگز ترس از مردن، یا دیوانه شدن یا از دست دادن کنترل را به خاطر نشانه‌های فیزیولوژیکی بیان نمی‌کنند. اغلب این کودکان اضطراب نامشخص از بیمار شدن را گزارش می‌دهند یا از استفراغ کردن می‌ترسند زیرا پیش بینی یا کنترل آن را دشوار می‌دانند بر طبق نظر موریف و مولت در سال 1993 شایعترین نشانه‌های وحشتزدگی گزارش شده در کودکان و نوجوانان شامل لرزش و رعشه، تپش قلب، سرگیجه، از حال رفتن، تنگی نفس، تعریق (در کودکان بزرگتر)، ترس‌از مردن یا از دست دادن کنترل است. کودکان خردسال معمولا حالت‌های هیجانی‌شان را برحسب بیماری جسمی توصیف می‌کنند. (ماش و بارکلی، ترجمه‌‌ی توزنده جانی، توکلی زاده و کمال پور، 1383).

هراس‌ها24
هراس اجتماعی : این نوع‌اضطراب خیلی عمومیت دارد و با ترس مفرط در تقریبا همه موقعیتهایی که فرد در اجتماع قرار می‌گیرد همراه است بدلیل اینکه تشویش اجتماعی خیلی عمومیت دارد اغلب به نظر بی اهمیت قلمداد می‌شود بسیاری اوقات از آن چشم پوشی می‌شود

منابع پایان نامه ارشد درمورد کارکنان بانک، سطح معنادار

مفروضه های آمار پارامتریک رعایت شده باشد و مهم ترین مفروضه این است که هر دو متغیر دارای حداقل مقیاس فاصله ای باشند (خلعتبری، 1385، ص 28).

فصل چهارم
تجزیه و تحلیل داده

4-1مقدمه
هدف نهایی هر تحقیق بدست آوردن نتایج کلی و قابل تعمیم است که ممکن است برای تعیین پدیدهها و پیشبینی رویدادهای آینده بکار روند. پژوهشگران برای دستیابی به جواب سؤالات تحقیق و آزمون فرضیههای خود نیازمند تحلیل و تفسیر دادههای موجود هستند تا بتوانند روابط میان مسائل تحقیق را مطالعه کنند (شریفی، به نقل از اسماعیلتبار، 1388).
در این بخش برای تجزیه و تحلیل اطلاعات از روش آمار توصیفی و آمار استنباطی استفاده شده است. در بخش آمار توصیفی از (نمودار، فراوانی و درصد فراوانی) و در بخش آمار استنباطی برای بررسی فرضیه اصلی تحقیق از آزمون رگرسیون چند متغیره و برای بررسی فرضیههای فرعی از آزمون ضریب همبستگی پیرسون استفاده شده است.
4-2 توصیف نمونههای آماری تحقیق
جدول 4-1: توزیع فراوانی و درصد فراوانی کارکنان بانک ملی استان گیلان برحسب جنسیّت
جنسیت
فراوانی
درصد فراوانی
زن
20
52/9%
مرد
190
48/90%
جمع
210
100%

نمودار شماره 4-1: توزیع فراوانی کارکنان بانک ملّی استان گیلان برحسب جنسیت.

نتیجه جدول نمودار شماره (4-1) نشان میدهد که تعداد 210 نفر حجم نمونه، 190 نفر (48/90 درصد) از حجم نمونه مرد و تعداد 20 نفر (52/9 درصد) از حجم نمونه زن هستند.

جدول 4-2: توزیع فراوانی و درصد فراوانی کارکنان بانک ملی استان گیلان برحسب سطح تحصیلات.
سطح تحصیلات
فراوانی
درصد فراوانی
دیپلم
148
47/70%
لیسانس
62
53/29%
جمع
210
100%

نمودار 4-2: توزیع فراوانی کارکنان بانک ملی استان گیلان برحسب سطح تحصیلات

نتیجه جدول و نمودار شماره (4-2) نشان میدهد که از تعداد 210 نفر حجم نمونه، 148 نفر (47/70 درصد) از حجم نمونه دارای تحصیلات دیپلم و تعداد 62 نفر (53/ 29 درصد) از حجم نمونه دارای تحصیلات لیسانس هستند.

جدول شماره 4-3: توزیع فراوانی و درصد فراوانی کارکنان بانک ملی برحسب سابقه کار
سابقهکار
فراوانی
درصد فراوانی
5-1 سال
34
19/16%
10-6
49
33/23%
15-11
31
76/14%
20-16
56
66/26%
25-21
28
33/13%
30-26
12
71/5%
جمع
210
100%

نمودار شماره 4-3: توزیع فراوانی و درصد فراوانی کارکنان بانک ملی برحسب سابقه کار

نتیجه جدول و نمودار شماره (4-3) نشان میدهد که از تعداد 210 نفر حجم نمونه 34 (19/16 درصد) دارای سابقه کار 5-1 سال و 49 نفر (33/23 درصد) دارای سابقه کار10-6 سال و 31 نفر (76/14 درصد) دارای سابقه کار 15-11 سال و 56 نفر (66/26 درصد) دارای سابقه کار 20-16 سال و 28 نفر (33/13 درصد) دارای سابقه کار 25-21 سال و 12 نفر (71/5 درصد) دارای سابقه 30-26 سال سابقه کار دارند.

4-3 اطلاعات جمعیت شناختی
در بخش آمار استنباطی برای تجزیه و تحلیل فرضیه اصلی تحقیق از رگرسیون چند گانه و برای بررسی فرضیه های فرعی تحقیق از آزمون ضریب همبستگی پیرسون استفاده شده است.
بررسی فرضیه اصلی تحقیق
بین کیفیت زندگی کاری (پرداخت منصفانه و کافی، محیط کار ایمن و بهداشتی، تأمین فرصت رشد و امنیت مداوم ، قانونگرایی در سازمان، وابستگی اجتماعی زندگی کاری، فضای کلی زندگی یکپارچگی و انسجام اجتماعی، توسعه قابلیت های انسانی) با تعهد سازمانی رابطه وجود دارد.
برای پاسخ دادن به فرضیه تحقیق فوق از رگرسیون چند گانه استفاده شده،که نتیجه ی آن در جداول زیر ارائه شده است:
جدول 4-4: میانگین و انحراف استاندارد کیفیت زندگی کاری و تعهد سازمانی
متغیرها
میانگین
انحراف استاندارد S
تعهد سازمانی
34/130
702/2
پرداخت منصفانه و کافی
26/22
504/2
محیط کار ایمن و بهداشتی
40/12
360/2
تأمین فرصت رشد و امنیت مداوم
71/12
243/2
قانونگرایی در سازمان
65/25
573/5
وابستگی اجتماعی زندگی کاری
94/12
195/2
فضای کلی زندگی
88/21
319/3
یکپارچگی و انسجام
80/17
428/2
توسعه قابلیت های انسانی
37/14
591/3

جدول4-5: ضریب همبستگی بین میزان کیفیت زندگی کاری و تعهد سازمانی
متغیرهای
سبک تدریس حل مسأله
پرداخت منصفانه و کافی
**443/0
محیط کار ایمن و بهداشتی
**374/0
تأمین فرصت رشد و امنیت مداوم
**243/0
قانونگرایی در سازمان
**211/0
وابستگی اجتماعی زندگی کاری
*147/0
فضای کلی زندگی
**254/0
یکپارچگی و انسجام
*145/0
توسعه قابلیت های انسانی
**187/0
**سطح معناداری در سطح 01/0
*سطح معناداری در سطح 05/0
نتایج جدول 4-5 نشان می دهد که بین پرداخت منصفانه و کافی با تعهد سازمانی به میزان (443/0) رابطه وجود دارد که این رابطه از لحاظ آماری در سطح 01/0 معنادار است، بین محیط کار ایمن و بهداشتی با تعهد سازمانی به میزان (374/0) رابطه وجود دارد که این رابطه از لحاظ آماری در سطح 01/0 معنادار است، بین تأمین فرصت رشد و امنیت مداوم با تعهد سازمانی به میزان (243/0) رابطه وجود دارد که این رابطه از لحاظ آماری در سطح 01/0 معنادار است، بین قانونگرایی در سازمان با تعهد سازمانی به میزان (211/0) رابطه وجود دارد که این رابطه از لحاظ آماری در سطح 01/0 معنادار است، بین وابستگی اجتماعی زندگی کاری با تعهد سازمانی به میزان (147/0) رابطه وجود دارد که این رابطه از لحاظ آماری در سطح 05/0 معنادار است، بی
ن فضای کلی زندگی با تعهد سازمانی به میزان (254/0) رابطه وجود دارد که این رابطه از لحاظ آماری در سطح 01/0 معنادار است، بین یکپارچگی و انسجام و تعهد سازمانی به میزان( 145/0) رابطه وجود دارد که این رابطه از لحاظ آماری در سطح 05/0 معنادار است. بین توسعه قابلیت های انسانی به میزان (187/0) رابطه وجود دارد که این رابطه از لحاظ آماری در سطح 01/0 معنادار است.

جدول 4-6: شاخصها و آمارهای تحلیل رگرسیون در زمینه ی فرضیه اول تحقیق

ضریب همبستگی R
مجذور ضریب همبستگی R2
مجذور ضریب همبستگی تعدیل شده R2
خطای معیار
پرداخت منصفانه و کافی
443/0
197/0
193/0
920/6
پرداخت منصفانه و کافی محیط کار ایمن و بهداشتی
509/0
259/0
252/0
660/6
پرداخت منصفانه و کافی محیط کار ایمن و بهداشتی فضای کلی زندگی
524/0
257/0
264/0
606/6

نتایج جدول فوق نمایان گر این است که پرداخت منصفانه و کافی فقط 3/19 درصد از واریانس میزان تعهد سازمانی را تبیین می کند و پرداخت منصفانه و کافی و محیط کار ایمن و بهداشتی به میزان 2/25 درصد واریانس تعهد سازمانی را تبیین می کند و پرداخت منصفانه و کافی و محیط کار ایمن و بهداشتی و فضای کلی زندگی به میزان 4/26 درصد واریانس تعهد سازمان را تبیین می کند.

جدول 4-7: آزمون تحلیل واریانس برای بررسی معنی دار بودن مدل مورد استفاده (Stepwise)

منابع تغییرات
مجموع مجذورات S.S
درجات آزادی d.f
میانگین مجذورات M.S
آزمون F
سطح معناداری
متغیر پرداخت منصفانه و کافی
رگرسیون
683/2437
1
683/2437
911/50
0001/0

باقی مانده
312/9959
208
881/47

جمع
995/12396
209

متغیر های پرداخت منصفانه و کافی و محیط کار ایمن و بهداشتی
رگرسیون
014/3216
2
007/1608
255/36
0001/0

باقی مانده
982/9180
207
353/44

جمع
995/12396
209

متغیرهای پرداخت منصفانه و کافی و محیط کار ایمن و بهداشتی و فضای کلی زندگی
رگرسیون
168/3406
3
389/1135
014/26
0001/0

باقی مانده
827/8990
206
645/43

جمع
995/12396
209

نتایج جدول 4-7 نشان می دهد که چون F محاسبه شده (0005/0P<) ، 911/50=(208 و1= d.f )F ) چون سطح معناداری از سطح (05/0= P) کوچکتر است بنابراین F محاسبه شده معنادار است، با عنایت به معنادار شدن نسبت F با احتمال 99/0 اطمینان متغیر اولی که وارد معادله رگرسیون شده است (پرداخت منصفانه و کافی) حداقل می تواند یکی از متغیرهای پیش بینی کننده تعهد سازمانی باشد. و همچنین با توجه بهF محاسبه شده متغیرهای (پرداخت منصفانه و کافی ، محیط کار ایمن و بهداشتی (0005/0P< ، 255/36 =(207 و2= d.f )F ) چون سطح معناداری از سطح (05/0= P) کوچکتر است بنابراین F محاسبه شده معنادار است، با عنایت به معنادار شدن نسبت F با احتمال 99/0 اطمینان متغیر اول و دوم که وارد معادله رگرسیون شده است (پرداخت منصفانه و کافی و محیط کار ایمن و بهداشتی) حداقل می توانند یکی از متغیرهای پیش بینی کننده تعهد سازمانی باشند. و همچنین با توجه بهF محاسبه شده متغیرهای (پرداخت منصفانه و کافی ، محیط کار ایمن و بهداشتی و فضای کلی زندگی ) (0005/0P< ، (206 و3= d.f )F ) چون سطح معناداری از سطح (05/0= P) کوچکتر است، بنابراین F محاسبه شده معنادار است ، با عنایت به معنادار شدن نسبت F با احتمال 99/0 اطمینان متغیر اول و دوم و سوم که وارد معادله رگرسیون شده اند (پرداخت منصفانه و کافی و محیط کار ایمن و بهداشتی و فضای کلی زندگی) می توانند از متغیرهای پیش بینی کننده تعهد سازمانی باشند. جدول 4-8: متغیرهایی که با استفاده از مدل Stepwise وارد معادله رگرسیون شده اند

منابع پایان نامه ارشد درمورد عملکرد کارکنان، حقوق و دستمزد، کارکنان بانک، عدم تمرکز

موافقند :
1- رویکرد رفتارگرایی75: رویکرد رفتاری به تعهّد متوجه فرایندی است که توسط آن افراد احساس وابستگی نه به سازمان بلکه به کار خود پیدا می کنند .
2- رویکرد نظری76(نگرشی): بیشترین تحقیقات بر این رویکرد انجام می شود که ماهیت و کیفیت ارتباط بین کارمند و سازمان را منعکس می کند ( صمد ، 2005، ص68 ) .
مودی و دیگران تعهّد را به شیوهای تعریف میکنند که در آن فردی که دارای تعهّد بالایی است:
الف) اعتمادی نیرومند نسبت به پذیرش اهداف و ارزش های سازمان دارد .
ب) تمایل به انجام تلاش قابل توجّه در راه سازمان دارد .
ج) قویّاً مایل به حفظ عضویت در سازمان است .
“بوکانان”77 : تعهّد سازمانی بر ادراکات کارکنان از اتّحاد و دلبستگی شان با کل سازمان متمرکز است (فدرو و دیگران، 2006). “وبر” در نظریه سازمانها با عنوان بوروکراسی معتقد است برای اینکه بتوان به بیشترین میزان تعهّد سازمانی دست یافت تقسیم کار منظم و دقیق لازم است، بنابراین به نظر وبر وجود عقلانیت باعث افزایش تعهّد سازمانی میشود. در سازمان بوروکراتیک انتخاب کارمندان بر مبنای ضوابط عینی که از جانب مدیران سازمان تعیین می شود صورت می گیرد و در این صورت است که اعضاء سازمان نسبت به محیط کارشان تعهّد سازمانی پیدا می کنند (اقتداری، 1373، ص 7). “مارکس” تعهّد سازمانی را از عوامل مربوط به تولید در سازمان می داند و معتقد است که تعهّد کارگر یا کارمند نسبت به سازمان باعث از خود بیگانگی او می شود. “وبر” این باور است که کار بیگانه در سازمان حالت شیء پرستانهای پیدا می کند . بدین معنی است که انسان تحت تسلّط فرآیند کار یا تعهّد سازمانی و کاری که ساخته و پرداخته خود اوست قرار می گیرد و بجای اداره کردن آن، تحت سیطره سازمان قرار می گیرد، سازمان کار او را اداره میکند، یعنی انسان بجای فاعل بودن مفعول است. بدین صورت از خودبیگانگی در میان اعضاء سازمان حاصل می شود (کوزر، 1369، ص 85). در جامعه شناسی “مارکس” تعهّد سازمانی درحکم فرهنگ مسلط سازمانی است که توقعّات اجتماعی و هنجارهای فرهنگی و ارزش را در اعضاء سازمان درونی می کند و با احاطه کامل بر زندگی اجتماعی اعضاء سازمان آنها را تحت یک قالب خاص در سوگیریهای شخصی مشابهی همسو و همنوا میکند و موجب بیگانگی او از یک طرف و عدم آگاهی از منافع سازمانی از جانب دیگر میشود (گیدنز78، 1374، ص 52).

نمودار 2-4 : مدل سه بخشی تعهّد سازمانی “آلن” و “مه یر” به نقل از ساروقی ، 1374

ماهیت ارتباط فرد با سازمان در هر یک از اجزای سه گانه تعهّد عاطفی، هنجاری و مستمر متفاوت است. کارکنان با تعهّد عاطفی قوی در سازمان می توانند بمانند چون می خواهند بمانند. افرادی که تعهّد مستمر قوی دارند میمانند چون نیاز دارند بمانند و آنهایی که تعهّد هنجاری قوی دارند میمانند چون احساس میکنند باید بمانند. پیش فرضهای تعهّد عاطفی به چهار گروه دستهبندی میشود: ویژگی های شخصیتی (مثل سن، سابق? خدمت، سطح تحصیلات، جنسیت، وضعیت تأهّل و… ) ویژگیهای شغل (مثل حیطه شغل، تضاد نقش، ابهام نقش) ویژگیهای ساختاری (مثل رسمیت، تمرکز، اندازه سازمان) تجربیات کاری (منظور تجربیاتی است که فرد در دوران زندگی کاری خود بدست میآورند) .
تعهّد مستمر دارای دو پیش فرض است. حجم و اندازه سرمایه گذاری های فرد در سازمان (زمان و نیروی صرف شده برای یادگیری راهکارها، مهارتهای مخصوص سازمان که قابل انتقال به سازمانهای دیگر نیست و درک فقدان فرصتهای شغلی در خارج از سازمان) .
تعهّد مستمر از تجربیات فرد قبل از ورود به سازمان (اجتماعی شدن خانوادگی- فرهنگی) بعد از ورود به سازمان (اجتماعی شدن سازمانی) متأثّر است .
تحقیقات زیادی در رابطه با تعهّد سازمانی با عملکرد شغلی و رفتارهای مبتنی بر تابعیت سازمانی انجام شده است که نتایج آن بیشتر مستقیم (مثبت) است و ارتباط تعهّد سازمانی با ترک خدمت، غیبت و تأخیر کارکنان معکوس (منفی) است (ساروقی، 1374، ص91 ).
2-24 عوامل تعیین کننده تعهّد
مؤسسه تحقیقی ارزیابی بین المللی با توجّه به تحقیقاتی که در فاصله سالهای 1999 تا 2001 انجام داد عوامل تعیین کننده تعهّد را به صورت زیر بیان کرد (گیانکولا، 2006، ص54 ):
1- کیفیت رهبری سازمان و شرکت
2- فرصت های تقویت کاری
3- مهارت های مدیریت انسانی مدیران بی واسطه
4- فرصت های رشد
“واستون وایت” در تحقیقی که انجام داد (2000) عوامل تعیین کننده و محرّک تعهّد را به صورت زیر بیان کرد (گیانکولا، 2006، ص22):
1- اعتماد به رهبر ارشد
2- قابلیت رقابت پاداش ها
3- دستکاری و انسجام رهبری شرکت
4- کیفیت محصولات و خدمات تولیدی شرکت و سازمان
5- امنیت شغلی
6- فقدان استرس های مرتبط با شغل
7- فرصت بکارگیری مهارت ها در کار
2-25 مقدمات ایجاد تعهّد
ماتیو و زاجاک (1990) با تجزیه و تحلیل بیش از 200 تحقیق ، مقدمات ایجاد تعهّد را به پنج دسته به شکل زیر تقسیم می کنند (اسماعیلی، 1380، ص42) :
الف- ویژگیهای شخصیتی مؤثّر بر تعهّد سازمانی (سن، جنسیت، تحصیلات، وضعیت تأهل، استنباط از شایستگی شخصی، تواناییها، حقوق و دستمزد) .
ب- خصوصیات شغلی مؤثّر بر تعهّد سازمانی (مشاغل غنی شده، تنوع مهارت، استقلال مشاغل، چالش انگیز بودن مشاغل).
ج- روابط گروهی و رابطه با رهبر و تعهّد سازمانی (انسجام گروه، وابستگی متقابل، وظایف، ارتباطات رهبر) (فیلدز و تاکر، 1992، ص84)79 .
د- ویژگیهای سازمان و تعهّد سازمانی (اندازه، سازمان، عدم تمرکز و …).
ر- وضعیت نقش و تعهّد سازمانی ( تضا
د نقش، ابهام نقش، تعدّد نقش).
2-26 شیوه های تقویت تعهّد سازمانی کارکنان
برای تقویت و بالا بردن میزان تعهّد سازمانی کارکنان راههای متفاوتی وجود دارد ، موارد زیر شمه ای از این راههاست ( “دسلر”، 1379، ص65 ) .
– داشتن مأموریت و ایدئولوژی سازمانی و واضح و روشن .
– سهیم کردن کارکنان
– ایجاد حس بیگانگی
– دریافت شکایات
– ایجاد حس جمعی و تأکید بر همکاری جمعی
– پیشرفت کارکنان ، شکوفا نمودن و توانمندسازی آنان
– نسبت سازی
– تضمین عدالت سازمانی
– انتخاب مدیران مناسب
– امنیت شغلی
– برقراری ارتباط دو جانبه بین مدیران و کارکنان سازمان .
2-27 ارتباط کیفیت زندگی کاری و تعهد سازمانی
یکی از موضوعاتی که فکر بسیاری از مدیران را به خود مشغول می دارد مدیریت منابع انسانی است، مدیران معمولاً نسبت به ادار? صحیح این منابع دیدگاههای متفاوتی دارند علت اساسی این امر وجود جنبه های گوناگون در حوز? منابع انسانی است، امروزه موضوع کیفیت زندگی کاری (QWL) کارکنان بسیار مورد توجه قرار گرفته چرا که دانشمندان دریافتند که بهبود شرایط زندگی خانوادگی و شرایط کاری که هر دو جزء لاینفک زندگی افراد به شمار می روند موجب بهبود روحیه و انگیزه کارکنان می گردد و در نتیجه موجبات افزایش رضایت خاطر آنان از زندگی و شغل خود و همچنین افزایش وفاداری و دلبستگی افراد به سازمان می گردد، کیفیت زندگی کاری شامل هشت مؤلفه (پرداخت منصفانه و کافی، محیط کار ایمن و بهداشتی، تأمین فرصت رشد و امنیت مداوم، قانونگرایی در سازمان ، وابستگی اجتماعی زندگی کاری ، فضای کلی زندگی ، یکپارچگی و انسجام اجتماعی در سازمان کار و توسعه قابلیت های انسانی) می باشد هر یک از جنبه ای کار و زندگی فرد را تشکیل می دهد اکنون سازمان ها دریافتند که انگیزه ها و پاداش های مادی، راه های موقتی هستند برای بهبود اثربخشی و بهره وری سازمان ها و تنها توجه به کیفیت و جنبه های گوناگون زندگی است که این نتیجه را در پی خواهد داشت از سوی دیگر تعهد سازمانی سالهاست که مورد توجه بوده و روی آن مطالعات متعددی صورت پذیرفته، دانشمندان برای تعهد سازمانی سه نوع تعهد عاطفی، هنجاری و مستعد در نظر گرفته اند، تعهد همان برگ برنده ای است که اگر سازمان آن را از سوی کارکنان خود داشته باشد هرگز به رکود و سقوط برخورد نمی کند از آنجا که کیفیت زندگی کاری بر تمامی جوانب کار افراد در سازمان از جمله رضایت و تعهد آنان به کار و سازمان اثر می گذارد و موجب شکل گیری هویت سازمانی خاصی و آرمان ها و اهداف مشترک برای افراد می گردد لذا پژوهش در زمینه بررسی و تعیین نوع رابطه حاکم بر این دو متغیر بسیار الزامی است چرا که شمول کامل بر این مباحث به مدیران حوزه منابع انسانی کمک می کند که هم روحیه و انگیزه کارکنان را بهبود بخشند و هم اثربخشی و بهره وری سازمان خود در افزایش دهند.
2-28 پژوهشهای انجام شده در ارتباط با موضوع تحقیق
2- 28-1 پژوهشهای انجام شده در ارتباط با موضوع تحقیق در داخل کشور
– محسن علّامه ( 1378 ) در رساله دکترای خود تحت عنوان ” بررسی قابلیت توسعه الگوی آرمانی کیفیت زندگی کاری والتون با ارزش های اسلامی و تأثیر الگوی توسعه یافته بر کاهش تنیدگی روانی ” نتایج زیر را بدست آورد .
در این تحقیق از پرسشنامه “والتون” و الگوی اسلامی کیفیت زندگی کاری و تنیدگی روانی استفاده شد . نتایج تحقیق وجود هفت رابطه معنادار بین مؤلفه های الگوی والتون را نشان می دهد .
شاخص نیکویی بر ارزش 995% برآورده گردید که حاکی از برازش مطلوب الگو است . این نتایج حاکمیت 31 رابطه معنادار بین 17 مؤلّفه الگوی اسلامی را نشان می دهد .
شاخص نیکویی برازش برای الگوی اسلامی 90% برآورد گردیده است که برآورد مطلوب را نشان می دهد. نتایج نشان میدهد که از بین مؤلّفههای 17 گانه الگوی اسلامی کیفیت زندگی کاری بین مؤلّفههای ارتباطات باز در سازمان، وفای به عهد سرپرست، ارزشیابی عملکرد متناسب با میزان تلاش واقعی فرد، آگاهی کارکنان از عملکرد مدیران با تنیدگی روانی ارتباط معناداری وجود دارد.
– تحقیق دیگری به وسیله رضایی ( 1379 ) با عنوان “بررسی رابطه بین رضایت شغلی و تعهّد سازمانی در بین کارکنان ستاد سازمان بهداشت و درمان صنعت نفت” انجام شده است که نتایج آن به شرح زیر است .
1- با افزایش میزان رضایت شغلی، میزان علاقهمندی کارکنان نسبت به شغل و سازمان خود و همچنین نسبت به ارزشهای آن افزایش مییابد که موجب افزایش تعهّد سازمانی کارکنان و استمرار خدمت آنان در سازمان خواهد شد .
2- رابطه رضایت شغلی با بعد هنجاری تعهّد سازمانی قویتر از سایر ابعاد است .
3- بین میزان رضایت شغلی با توجّه به سطح تحصیلات آنان تفاوت وجود دارد .
4- بین میزان تعهّد سازمانی کارکنان با توجّه به سطح تحصیلات و سابق? کار آنها تفاوتی وجود ندارد .
– شهر آشوب ( 1385 ) در پایاننامه خود تحت عنوان “بررسی رابطه بین کیفیت زندگی کاری و تعهّد سازمانی دبیرستانهای شهرستان گنبد کاووس “با استناد از مؤلّفههای هشت گانه “والتون” به این نتیجه رسیده که رابطه مثبت و معنی داری بین کیفیت زندگی کاری و تعهّد سازمانی وجود دارد (تقی آشوب، 1385، همان منبع) .
– نجفی (1385) در پایان نامه خود تحت عنوان “بررسی رابطه بین کیفیت زندگی کاری با بهره وری مدیران میان شرکت کنندگان ایران “با استفاده از مؤلّفههای “کاسیو” نتیجهگیری میکند که بین کیفیت زندگی کاری و بهرهوری مدیران میانی همبستگی مثبت و معناداری وجود دارد . یع
نی با بالا رفتن کیفیت زندگی کاری ، بهره وری آنان نیز بهبود می یابد . ضریب تعیین نشانگر این مطلب است که حدود 20% از بهره وری مدیران ناشی از کیفیت زندگی کاری و 80% باقی مانده بر اثر تأثیر عوامل است .
– فلاح (1385) در پایان نامه خود تحت عنوان بررسی و تجزیه و تحلیل “رابطه کیفیت زندگی کاری و عملکرد کارکنان سازمان اقتصادی کوثر” به این نتیجه رسید که بین کیفیت زندگی کاری و عملکرد کارکنان رابطه معناداری وجود دارد. او نیز در این تحقیق از مؤلّفههای “والتون” استفاده کرد .
– تعالی (1374) در پایان نامه کارشناسی ارشد خود تحت عنوان ” بررسی اثرات کیفیت زندگی کاری بر روی بهره وری کارکنان بانک های کشور به این نکته توجّه نموده است که آیا اصولاً بین بهبود کیفیت زندگی کاری در بانکهای کشور و بهره وری آنها رابطه ای وجود دارد یا خیر ؟ چنانچه رابطه ای وجود دارد میزان آن چگونه و تا چه اندازهای است و همچنین کدام عامل کیفیت زندگی نسبت به عوامل دیگر رجحان بیشتری دارد ؟ جامعه آماری وی شامل کارکنان شعب بانک های مختلف تهران است و به روش نمونه گیری تصادفی طبقه ای نمونه گیری کرده است .
فرضیات وی شامل: 1- بهبود کیفیت زندگی کاری باعث بهره وری می شود . 2- شعب دارای بهره وری بالا رضایت بیشتر مشتری را هم دارند . 3- شعبی که کارکنان آن کیفیت زندگی کاری مطلوب تری دارند نسبت به شعب گروه دیگر دارای بهره وری بالاتری هستند. جمعآوری اطلاعات به وسیله پرسشنامه، مصاحبه، کتابخانه و مشاهدهای بوده است. روشهای آماری متناسب با فرضیات بوده است ، فرضیات تحقیقی به تأیید رسیده است و مهمترین عامل مؤفّقیت بانکها جلب رضایت مشتری بوده است . به همین خاطر توصیه می کند که آموزشهای لازم را به کارکنان در خصوص برخورد مناسب با مشتری بدهد و رفع نیازهای کارکنان از عوامل مؤثّر در افزایش بهرهوری آنان بوده است و نظام پرداخت را باید سالانه در نظر گرفت و رؤسای بانکها باید در توزیع امکانات بین کارکنان عدالت را رعایت کنند تا انگیزه های کاری در کلیّه کارکنان ایجاد یا تقویت شود و در عین نظارت باید آزادی عمل هم به کارکنان داد و چون امور مالی و پولی نیاز به دقّت زیادی دارد رؤسای بانکها باید محیط کار را برای کارکنان در نهایت ایمنی، آرامش و دور از هر گونه تنش قرار دهد .
– داوودی ( 1377 ) در تحقیقی با عنوان ” بررسی تأثیر کیفیت زندگی کاری بر رضایت شغلی بین کارکنان عملیاتی شاغل در مجتمع فولاد مبارکه ” به این نکته توجّه نموده است که چگونه می توان موجبات افزایش میزان کیفیت زندگی کاری را با توجّه به شرایط و وضعیت فرهنگی کشور فراهم آورد ، لذا با توجّه به ابعاد فراوان کیفیت زندگی کاری و محدود بودن امکانات پژوهشگر ، محقق توجّه خود را به مشارکت به عنوان اساس کیفیت زندگی کاری معطوف نموده که در این زمینه به دو زمینه مشترک در زمینه های فوق با رضایت شغلی و حوادث شغلی در بین کارکنان عملیاتی شاغل در مجتمع فولاد مبارکه در یک نمونه 116 نفری پرداخته است و فرضیات زیر را آزمون کرده است : مشارکت دادن غیررسمی کارکنان عملیاتی در تصمیمگیریهای مربوط به شرایط کاری موجب افزایش رضایت شغلی آنان میشود؛ مشارکت دادن غیررسمی کارکنان عملیاتی در تصمیمگیریهای مربوط به خودکار موجب افزایش رضایت شغلی می شود ؛ مشارکت دادن غیررسمی کارکنان عملیاتی در تصمیم گیری های مربوط